This site provides information about the adverse effects of vaccines. Many people want to make an informed choice whether to vaccinate their children or not. This site and its links can help to clarify some of the misunderstandings and myths about the safety and efficacy of vaccines. The differences between real lifelong immunity compared to short term vaccine induced high antibody levels are also explored.
"First do no harm" - Hippocratic oath
Vaccines are based on a simple premise – they are a 1 Dimensional view of the immune system. We assume that we can safely mimic the immune system and manipulate how it works. (The Story Behind Vaccines with Dr. Lawrence Palevsky - Your Health. Your Story. - 7th July 2024)
We know that when you encounter a disease the body makes antibodies against it. Some of these antibodies are memory cells: which remember the disease and remain ready to fight it again. This confers on us – long-term immunity to that disease (sometimes life-long) and antibodies can be passed on from mother to infant down the generations protecting the vulnerable young. When the majority of people have antibodies against this disease - this is called Herd immunity. Disease finds it difficult to get going when most people are immune to the disease.
Sounds great doesn’t it? – That’s real natural immunity and its benefits - not fake, short-term vaccine induced, high antibody levels - that you get from vaccination - that’s a whole different ball game.(Not just antibodies: B cells and T cells mediate immunity to COVID-19 - Nature 24th August 2020) (T cells are really the superstars in fighting COVID-19 - BMJ September 2020) (Signature of long-lived memory CD8 T cells in acute SARS-CoV-2 infection - Nature - 7th December 2022) (Original Antigenic Sin: How First Exposure Shapes Lifelong Anti-Influenza Virus Immune Responses - The Journal of Immunology - 15th January 2019) (Waning immunity of the BNT162b2 vaccine: A nationwide study from Israel - MedRxiv - 24th August 2021) (Innate Immune Suppression by SARS-CoV-2 mRNA Vaccinations: The role of G-quadruplexes, exosomes and microRNAs - Authorea - 21st January 2022) (Persistent immune imprinting after XBB.1.5 COVID vaccination in humans - BioRXiv - 28th November 2023)
The immune system evolved over millions of years – it knows what its doing - otherwise we would never have survived to become almost 8 Billion worldwide and counting. The immune system is infinitely way more complex - than that simple 1 Dimensional view. Natural immunity is far superior in every way to the vaccines unnaturally stimulated fake immunity. Any artificial immunity conferred by a Vaccine wanes after a very short period of time - weeks - months or 1 or 2 years – then you need boosters and then more boosters and then more boosters - ad infinitum.
(RNA-Based Vaccine Technology: The Trojan Horse Did Not Contain mRNA - Epoch Health - 21st April 2023) (T-Cell Epitope Mapping of SARS-CoV-2 Reveals Coordinated IFN-y Production and Clonal Expansion of T Cells Facilitates Recovery from COVID-19 - MDPI - 22nd June 2024)
According to recent research - Natural infection is far superior to vaccination. Natural infection provides potent immunity with greater evolution of antibodies over time, which provides increased neutralising activity and greater breadth of immunity to antigens and variants.
(Anti-SARS-CoV-2 receptor binding domain antibody evolution after mRNA vaccination - Nature 7th October 2021) Research has shown that high antibody levels are not immunity - people with high antibody levels can still get the disease and people with no antibodies or low levels can be immune. Why is that? Because high antibody levels do not guarantee immunity - they are only a sign that the person has been exposed to a disease. The immune system is far more complex and antibody levels are a tiny fraction of the complex cascade of different cells and factors in producing true immunity to a disease. New research has shown that people with no antibodies to the disease have immunity because of other cells such as memory T cells and other cells and organs and factors of the immune system.(BNT162b2 COVID-19 vaccination in children alters cytokine responses to heterologous pathogents and Toll-like receptor agonists - Frontiers - 25th August 2023) (Pre-existing immunity to Sars-Cov-2: the knowns and the unknowns - Nature-Immunology) (See link here: Nature - T cell Immunity) (Having SARS-CoV-2 once confers much greater immunity than a vaccine - Science)(Comparing SARS-CoV-2 natural immunity to vaccine induced immunity: reinfections versus breakthrough infections - medRxiv 25th Aug 2021) (Beating Measles With Toilets - The Swachh Bharat Mission - Principia Scientific - 25th September 2023)
Vaccines only tinker around the edges of a vast complex that is still poorly understood and mainly unknown. A little knowledge is a dangerous thing and it is destroying our immune systems. (Class switch toward non-inflammatory, spike-specific IgG4 antibodies after repeated SARS-CoV-2 mRNA vaccination - ScienceImmunology - 22nd December 2022) (Assessment of inactivated Influenza-A Vaccine after 3 outbreaks of Influenza A at Christ's Hospital - The Lancet - 6th January 1979) (Antibody feedback regulates immune memory after SARS-CoV-2 mRNA vaccination - Nature - 6th December 2022) (IgG4, CD4s and why the LNP/mRNA platform should be prohibited - Unacceptable Jessica - Substack - 14th August 2023)
Vaccine induced artificial immunity is not passed down the generations and is not passed well from mother to infants – so you do not get the protection of herd immunity from vaccines in the same way as with natural immunity. This means that infants are left far more susceptible to disease in the first few years of life because the mother has no real immunity and is relying on artificial immunity, which wanes quickly and is not passed on to the child. (vaccine immunity) (Durability of immune responses to the BNT162b2 mRNA vaccine - BiorXiv 30th September 2021) (Evolution of Antibody Immunity - Nature) - (Necessity of COVID-19 vaccination in previously infected individuals - medRxiv) (SARS-COV-2 specific plasma cells are not durably established in the bone marrow long-lived compartment after mRNA vaccination - Nature Medicine - 27th September 2024)
Vaccines force the immune system to go into inflammatory response but not in the proper manner – so the inflammatory response can remain unabated – confusing the immune system and making the person much more susceptible to other strains and other diseases. Vaccines dysregulate the immune system and weaken it to varying degrees. They can also interfere with our ability to mount an appropriate immune response and they can make us more susceptible to other strains and types of diseases - a phenomenon called virus interference. (Wolff GG. Influenza vaccination and respiratory virus interference) (See link here: PMC article Seasonal Influenza Vaccination and heightened risk of other virus infections)
(Infection-enhancing anti-SARS-Cov-2 antibodies recognise both the original Wuhan/D614G strain and Delta variants. A potential risk for mass vaccination? - Journal of infection) (Synaptic pruning by microglia is necessary for normal brain development - PubMed - 9th September 2011)
(Natural IgG Anti-F (ab')2 Autoantibody Activity in Children with Autism - PubMed - 27th February 2023) (IgG4 Antibodies Induced by Repeated Vaccination May Generate Immune Tolerance to the SARS-CoV-2 Spike Protein - MDPI - 17th May 2023)
Live vaccine viruses also shed. Live viral vaccines like MMR are known to cause outbreaks in people recently vaccinated and others around them.
During mass vaccination campaigns before school – college – university starts we introduce live virus vaccine disease into the population and then get surprised when the majority come down with Measles or Mumps - whether vaccinated or not. Research has shown that the majority who get the diseases have been vaccinated. The majority of outbreaks now are created by mutated, highly virulent virus strains from the vaccines - not the wild strains, many of which were comparatively milder and gave life-long immunity and other health benefits eg protection against cancers.
In this 1 dimensional simplified view of the world – vaccines are touted to be able to wipe out diseases completely. Whole nations are expected to be measles and mumps free – the WHO even gave out measles free status and polio free status to some countries - then had to retract it almost immediately afterwards. Its impossible to be disease free – the world doesn’t work that way – life doesn’t work that way, bacteria and viruses will always find a way to survive – by continually evolving. That’s like saying you are going to stop the world turning or hold the tide back.
How could we ever become disease free – especially when we are continually introducing disease to the populations through the vaccines and everyone is shedding it all around. Complete fantasy – wrong world view. ( Imperfect Vaccination Can Enhance the Transmission of Highly Virulent Pathogens - Plos Biology) (Antibody-dependent enhancement and SARS-CoV-2 vaccines and therapies - Nature microbiology)
(Immune imprinting, breadth of variant recognition, and germinal center response in human SARS-CoV-2 infection and vaccination) - Elsevier - 17th March 2022) (Measles: Unvaccinated Not to Blame for Outbreaks + Other Fun Facts - The Defender - 28th July 2023)
In order to make vaccines you need the diseases themselves – a ready supply of disease bacteria and viruses and toxins - and you need to grow and produce them in live cells or they will die or decay. So you need a large and ready supply of diseases – to make vaccines available to everyone. Vaccines also need preservatives and immune stimulants and oils and other chemicals to mix them and keep them in suspension.
Anything you inject into the body can and does stimulate antibodies – not just the antibodies you want - but other ones you don’t want eg antibodies against your own proteins - or antibodies against DNA or RNA eg the growth cells in the vaccines. ('It's Not Just Autism': The U.S. Rate of Chronic Disease Has Exploded from 6% in 1968 top 54% in 2006 - Rumble - The Vigilant Fox - 8th January 2022)
(Evolving understandings for the roles of non-coding RNAs in autoimmunity and autoimmune disease - ScienceDirect - 7th November 2022)
(HPV Vaccine Mandate to Attend College - Epoch Health - 21st April 2023)
Vaccines are filled with debris from the manufacturing process – a vaccine is not just a Vial with a bit of weakened disease and some saline. Its full of all sorts of things the Immune system may respond to with antibodies. Not only are there weakened live diseases and dead disease products and proteins: some vaccines (Flu vaccines) contain Mercury (preservative) in variable amounts and Aluminium (immune stimulator) in variable amounts. (Expert on Aluminum Toxicity Forced Out of University - Epoch Health - 25th November 2022) They also contain debris from the manufacturing process such as metals and debris from the cells the diseases were grown in –strands of DNA and RNA and proteins and viruses from the Human – Animal and Insect cells that we grow our vaccine disease strains on. (The Vaccine Industry's Dirty Secret - Principia Scientific - 17th January 2023) (Merck's dirty little secret. Vaccines and aluminum history you are not supposed to know - Dr. Susanne Humphries - 23rd April 2022)
Vaccines are full of debris that should not be there. Anyone injected with it will not only make antibodies to the disease - but will also usually make antibodies to the components of the debris. (Toxic pollutants in vaccines: Dr. Montanari and Dr. Gatti - Corvelva)
(Bombshell - Corvelva Releases Next Vaccine Analysis Results - Real News Australia - 23rd December 2018)
(Microscopy of contamination in 44 types of vaccines - International Journal of Vaccines & Vaccination)
(Shocking Lab Investigation of COVID Vaccines - Epoch Health - 1st January 2023) (Would you like Plasmids with that? - Arkmedic - 17th October 2024)
Oils for emulsion of vaccines can induce fatal allergies. Eg peanut oil – seed oils – fish oils – plant oils. Both Mercury and Aluminium are nerve poisons (neurotoxins) they destroy nerves – especially nerve cells – brain cells and the coatings of the nerves eg myelin sheaths and glial cells. This can cause severe nerve damage and autoimmune diseases eg Multiple sclerosis, Motor Neurone Disease, Transverse Myelitis and Guillian Barre syndrome etc.. (COVID-19 mRNA vaccination leading to CNS inflammation: a case series - Journal of Neurology - 4th September 2021) (UK Babies Were Knowingly Given Toxic Vaccines 14x Stronger Than Intended By GlaxoSmithKline in the 60s/70s - Substack - Inversionism - 16th August 2023)
(The Increasing Prevalence of Autoimmunity and Autoimmune Diseases; An Urgent Call to Action for Improved Understanding, Diagnosis, Treatment and Prevention - PubMed - February 2023) (Time trends in the epidemiology of food allergy in England: an observational analysis of Clinical Practice Research Datalink data - the Lancet - September 2024)
DNA and RNA is universal – that means all living things use the same code. So the fragments of DNA and RNA in the debris of the vaccines contain the exact same bases (ATCG components) as our own DNA and RNA. So if antibodies are made against these strands after a vaccine - then the person’s immune system will begin to attack itself. (Autoimmune disease). (Genome-wide, integrative analysis implicates microRNA dysregulation in autism spectrum disorder - Nature Neuroscience - 29th August 2016) (Nuclear permeability during cell division - Anandamide - Substack - 5th June 2023) (Evolving understandings for the roles of non-coding RNAs in autoimmunity and autoimmune disease - ScienceDirect - 7th November 2022)
(Sequencing of bivalent Moderna and Pfizer mRNA vaccines reveals nanogram to microgram quantitiies of expression vactor dsDNA per dose - OSFPreprints - 10th April 2023) (Vaccination and multiple sclerosis - Dr. John Campbell - YouTube - May 2023)
Functional Neurological Disorder (FND) is a term now used to explain neurological symptoms seen after vaccinations. There have been many incidences of FND world-wide - from many different vaccines (eg HPV & Flu). These types of symptoms may be dismissed by health professionals in the first instance as all due to stress and to psychological factors. (Functional Neurological Disorder After SARS-CoV-2 Vaccines: Two Case Reports and Discussion of Potential Public Health Implications - Neuropsychiatry - 15th July 2021) (Novel Movement Disorders After COVID Vaccination: Patients Misdiagnosed, Treatment Delayed - Epoch Health - 2nd May 2023)
(Functional neurologic disorder associated with SARS-CoV-2 vaccination - PubMed - 15th August 2022)
(Long COVID Is Not a Functional Neurologic Disorder - MDPI - 29th July 2024)
Molecular mimicry also causes the immune system to attack itself - if components of the vaccines are not strictly checked for molecular mimicry (similarity or the same as human body components) - if they are similar to or mimic the bodies own components this can cause untold amounts of permanent damage to health and to the immune system - leading to some of the worst autoimmune diseases. eg Thrombocytopenia, Multiple Sclerosis - Lupus - POTS - Transverse Myeltis - Guillain Barre - ALS - Rheumatoid Arthritis - CVST - VITT - FND - Motor Neurone Disease etc.
Auto-antibodies can be made (permanently) by the persons own immune system after it has been dysregulated and damaged by molecular mimicry, resulting in a vast range of severe neurological diseases. (Reports of Guillain-Barre Syndrome After COVID-19 Vaccination in the United States - JAMA- 1st February 2023) (Molecular mimicry between SARS-CoV-2 and the female reproductive system - PubMed - 8th December 2021)
(Covid-19 and autoimmunity - PubMed - 11th June 2020) (COVID vaccines have likely caused over 25,000 new cases of multiple sclerosis (MS) - Steve Kirch - Substack - 29th May 2023) (Immune Dysregulation in Autism Spectrum Disorder: What Do We Know about It? - PMC - 11th March 2022) (Severe acute respiratory syndrome coronavirus and viral mimicry - The Lancet - 14th June 2003) ( COVID-19 and molecular mimicry: The Columbus' egg? - Journal of clinical neuroscience - 5th May 2020) (Is COVID-19 a proteiform disease inducing also molecular mimicry phenomena? - SpringerLink - 20th April 2020) (Nervous system consequences of COVID-19 - Science - 20th January 2022) (Potential Autoimmunity Resulting from Molecular Mimicry between SARS-C0V-2 Spike and Human Proteins - MDPI - 28th June 2022) (The SARS-CoV-2 as an instrumental trigger of autoimmunity - PubMed - 19th February 2021) (No one would ever accept permanent fever...So, why accept permanently high antibodies? Its's a "Death Zone"! - Substack - 30th January 2021) (The Rise of `POTS in the COVID-19 and Vaccine Era - Epoch Health - 17th July 2023)
(The Potential Role of SARS-CoV-2 Infection and Vaccines in Multiple Sclerosis Onset and Reactivation: A Case Series and Literature Review - PubMed - 18th July 2023) (Molecular mimicry between SARS-C0V-2 spikeglycoprotein and mammalian proteomes: implications for the vaccine - PubMed Central - 18th September 2020) (Postural orthostatic tachycardia syndrome as a sequela of COVID-19 - PubMed - 16th July 2022) (Apparent risks of postural orthostatic tachycardia syndrome diagnoses after COVID-19 vaccination and SARS-Cov-2 Infection - Nature - 12th December 2022)
These strands of DNA and RNA from other humans - male DNA/RNA - female DNA/RNA – animals - insects and pathogens can also become incorporated into our DNA and compromise our genomes in unknown/unresearched ways - they can cause genetic mutations - genetic alterations - misreading of genes - changes to gene expression and alien proteins to be made. Recent research shows that these changes to our genes can be passed down through the generations to our offspring with unknown consequences for humanity. (Nuclear translocation of spike mRNA and protein is a novel pathogenic feature of SARS-CoV-2 - BioRxiv - 27th September 2022) (Sars-CoV-2 RNA reverse-transcribed and integrated into the human genome) (mRNAs as biomarkers of autism spectrum disorder: a sytematic review and meta-analysis - Springer - 3rd February 2023)
(Reverse-transcribed SARS-CoV RNA can integrate into the genome of cultured human cells and can be expressed in patient-derived tissues - PNAS)
(Intracelular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 in Vitro in Human Liver Cell Line - MDPI - 25th February 2022) (Potential Mechanisms for Human Genome Integraton of Genetic Code from SARS-CoV-2 mRNA Vaccination - ResearchGate - November 2022) (Spontaneous Integraton of Human DNA Fragments in Host Genome - Sound Choice Pharmaceutical Institiute - T.A.Deisher)
(5 ways to skin a (genetically modified) cat - Substack - Dr Ah Kahn Syed - 1st October 2023) (SV40 origin of replication in mamalian cells in absence of SV40 Large T-Antigen - Anandamide - 14th October 2024)
Antibodies to cell proteins from the cells we grow the vaccines on – will also trigger our immune system to attack its own proteins (autoantibodies). There are also dangerous retroviruses and stray - monkey - dog - insect viruses and other diseases, in the human - animal and insect cells that we produce the vaccines in - which can be passed on to the vaccinated. (eg swine flu and bird flu viruses).
It is a dangerous lottery - what you get from the end of that needle - and how your particular immune system will react to it. But one thing we know –
if you inject the debris in vaccines – antibodies will be made – and not just the ones you want.
When you agree to vaccination you are playing Russian Roulette with your health and your children’s health. Think deeply and do the research very carefully – the real research is out there. The world is not as simple as the vaccine pushers would have you believe. (Undeniable Death Cases After HPV Vaccination - Epoch Health - 25th June 2023)
(BNT162b2 COVID-19 vaccination in children alters cytokine responses to heterologous pathogens and Toll-like receptor agonists - Frontiers - 25th August 2023) (COVID-19 vaccines immediate onset Autoimmune Disease adverse events in VAERS - Darrell O. Ricke, M.S.,PHD - 17th October 2023) (New-Onset Rheumatic Immune-Mediated Inflammatory Diseases Following SARS-CoV-2 Vaccinations until May 2023: Asystematic Review - MDPI 11th October 2023)
You may ask why would Vaccinologists – Immunologists - Scientists - Doctors - Health Authorities and Governments allow us to be injected with dangerous substances? The answer is why do they ever allow and promote any dangerous substance – drug or practice. If you look at history up to recent times you get your answer. Why did the same Health boards, Doctors and Scientists – allow contaminated blood products (eg Factor 8) to be given to haemophiliacs for decades after they knew that it would give thousands of people Aids and Hepatitis C. Why did they allow thousands of people to die and thousands more to become permanently sick? Because they can - People believe in them (Authority figures). People have faith in them. Blind faith. (SARS-CoV-2 Spike Protein Accumulation in the Skull-Meninges-Brain Axis: Potential Implication for Long-Term Neurological Complications in post-COVID-19 - BioRxiv - 4th April 2023)
These people don’t want to change their policies or to be seen to be wrong - ever. Once they decide on something or some policy they will fight tooth and nail to protect their decision. No matter how wrong it is – no matter how many people it kills. No matter how much scientific evidence to the contrary has been presented to them. Even if new information comes up that completely negates their policies and decisions they will ignore it – cover it up and deny – deny –deny - while people die. They are so pathologically enmeshed in their own 1 dimensional belief systems - careers – big egos – salaries – hefty bribes - prestige – reputation – hierarchical positions in society.
They are so way down the road of their own decisions and beliefs - that the truth begins not to matter to them - and other people become collateral damage. When their reputation and position in society is at stake – they lie – cover –up and hide the truth for as long as they can. Who will be finally responsible anyway? Certainly not them - Years from now – money will be paid out to victims but no-one will be called to account. We will pay out vast sums of taxpayer’s money to the injured and the maimed – but never change how it happened in the first place.
Do your research – if something is disputed by many – there is something to be explored. (Scientific Review of Vaccine Safety Datalink Information - Simpsonwood Documents June 2000) (Reaffirming a Positive Correlation Between Number of Vaccine Doses and Infant Mortality Rates: A Response to Critics - Cureus - 2nd February 2023) (CDC Reports: More than 1 in 10 Boys Have ID, ASD, or Another Developmental Delay - Safe Minds - 17th July 2023) (Kevan McKernan Talks COVID Vaccine DNA Contamination, the Monkey Virus SV40 Promoter, and What's Actually in the Vaccines - EpochTV - 29th August 2023) (The contaminated blood scandal - The Haemophilia Society - 2024) (Infected Blood Inquiry finds multiple failures - The Haemophilia Society - 20th May 2024)
Don’t close your ears and eyes and brain and look the other way. Don’t be comfortable and lazy believing the majority – find out for yourself if the majority are right. Very often what the majority believe is the easy comfortable lie. We believe it because everyone else believes it but no-body has really bothered to check it out - except a minority and they are ridiculed by us. It is always the minority that change the status quo and mostly for the betterment of society. (What are the risks and benefit of each vaccine? - A Midwestern Doctor - Substack - 5th April 2023)
Listen to the other side of the argument. In this world nothing is simple and nothing is completely known. No matter how vehemently the 1 dimensional believers shout that vaccines are safe and effective and the science is settled. Science is never settled – nothing is ever completely settled in this world. At any point a discovery will uncover something we knew nothing about - a discovery that changes our world and makes us see it in a different way. A discovery that makes the old ways obsolete. It happens all the time. Read an old science book – new discoveries make some of it completely wrong. Recently scientists discovered that the brain has its own immune system – we didn’t know – we hadn’t seen the structure. Our beliefs about the brain and immune system had to change because of it and are still changing. (Natural immunity lasts for at least 100 years - Substack - Dr. Paul Alexander 25th November 2023)
Do not fall for the 1 dimensional simplified propaganda – we don’t know all there is to know and probably never will. If it sounds simple and easy – it’s probably wrong. Don’t just line up for your vaccines and let your health be taken care of by strangers. Take care of your own health as much as possible. Millions fall for that line every day. Research and ask around – listen to both sides of every issue. Don’t take things on trust from the sources: that history confirms are not trustworthy. Think of smokers who were told by doctors and governments and media that cigarettes were good for their health. Think of Thalidomide – Di-ethyl Stilbestrol (DES) - DDT – Vioxx – Fentanyl - Factor 8 blood products – Opioid medicines dished out like sweets – Round up - carcinogenic weedkillers - Aspartame - Fluoride - SSRIs and Vaccines eg Anthrax and Swine Flu vaccines. (Gulf War Syndrome: Killing Our Own - The Expose - 31st January 2024) (Up to 500,000 Dead from a Headache Pill: These Vaccine Manufacturers Are Serial Felons - RFK Jr. - Rumble - 28th April 2023) (The Untold Purdue Pharma Story CNBC Kept Hidden - Rumble - Vigilant News Network - 11th July 2024)
An example is the Swine Flu vaccines in 2009 were rushed to market - resulting in many children and adults developing permanent lifelong neurological illness, Narcolepsy. (www.narcolepsy.org.uk/resources/pandemrix-narcolepsy). ( Up to 500,000 Dead from a Headache Pill - Rumble - 11th July 2022) (Lessons (Not) Learned From a Vaccination Campaign Catastrophe - Epoch Health - 29th November 2022) (The First Mandatory Vaccination Campaign That Crippled America's Pilots - Robert W Malone - Substack - 16th February 2023) (After Long Silence on 'Long Vax,' Science Magazine Links Autoimmune Disorders to COVID Shots - Epoch Health - 18th July 2023) (Episode 332: The Forbidden Debate - The Highwire - 10th August 2023) ( What Really Happened Inside the COVID-19 Vaccine Trials? - A Midwestern Doctor - Substack - 13th March 2023)
(ICAN - Informed Consent Action Network - Vaccines - No Placebos - icandecide.org - 24th July 2024) (ICAN - informedConsentActionNetwork - Get Informed - August 2024)
Do the research – your life and your children’s lives depend on it.
We know that when you encounter a disease the body makes antibodies against it. Some of these antibodies are memory cells: which remember the disease and remain ready to fight it again. This confers on us – long-term immunity to that disease (sometimes life-long) and antibodies can be passed on from mother to infant down the generations protecting the vulnerable young. When the majority of people have antibodies against this disease - this is called Herd immunity. Disease finds it difficult to get going when most people are immune to the disease.
Sounds great doesn’t it? – That’s real natural immunity and its benefits - not fake, short-term vaccine induced, high antibody levels - that you get from vaccination - that’s a whole different ball game.(Not just antibodies: B cells and T cells mediate immunity to COVID-19 - Nature 24th August 2020) (T cells are really the superstars in fighting COVID-19 - BMJ September 2020) (Signature of long-lived memory CD8 T cells in acute SARS-CoV-2 infection - Nature - 7th December 2022) (Original Antigenic Sin: How First Exposure Shapes Lifelong Anti-Influenza Virus Immune Responses - The Journal of Immunology - 15th January 2019) (Waning immunity of the BNT162b2 vaccine: A nationwide study from Israel - MedRxiv - 24th August 2021) (Innate Immune Suppression by SARS-CoV-2 mRNA Vaccinations: The role of G-quadruplexes, exosomes and microRNAs - Authorea - 21st January 2022) (Persistent immune imprinting after XBB.1.5 COVID vaccination in humans - BioRXiv - 28th November 2023)
The immune system evolved over millions of years – it knows what its doing - otherwise we would never have survived to become almost 8 Billion worldwide and counting. The immune system is infinitely way more complex - than that simple 1 Dimensional view. Natural immunity is far superior in every way to the vaccines unnaturally stimulated fake immunity. Any artificial immunity conferred by a Vaccine wanes after a very short period of time - weeks - months or 1 or 2 years – then you need boosters and then more boosters and then more boosters - ad infinitum.
(RNA-Based Vaccine Technology: The Trojan Horse Did Not Contain mRNA - Epoch Health - 21st April 2023) (T-Cell Epitope Mapping of SARS-CoV-2 Reveals Coordinated IFN-y Production and Clonal Expansion of T Cells Facilitates Recovery from COVID-19 - MDPI - 22nd June 2024)
According to recent research - Natural infection is far superior to vaccination. Natural infection provides potent immunity with greater evolution of antibodies over time, which provides increased neutralising activity and greater breadth of immunity to antigens and variants.
(Anti-SARS-CoV-2 receptor binding domain antibody evolution after mRNA vaccination - Nature 7th October 2021) Research has shown that high antibody levels are not immunity - people with high antibody levels can still get the disease and people with no antibodies or low levels can be immune. Why is that? Because high antibody levels do not guarantee immunity - they are only a sign that the person has been exposed to a disease. The immune system is far more complex and antibody levels are a tiny fraction of the complex cascade of different cells and factors in producing true immunity to a disease. New research has shown that people with no antibodies to the disease have immunity because of other cells such as memory T cells and other cells and organs and factors of the immune system.(BNT162b2 COVID-19 vaccination in children alters cytokine responses to heterologous pathogents and Toll-like receptor agonists - Frontiers - 25th August 2023) (Pre-existing immunity to Sars-Cov-2: the knowns and the unknowns - Nature-Immunology) (See link here: Nature - T cell Immunity) (Having SARS-CoV-2 once confers much greater immunity than a vaccine - Science)(Comparing SARS-CoV-2 natural immunity to vaccine induced immunity: reinfections versus breakthrough infections - medRxiv 25th Aug 2021) (Beating Measles With Toilets - The Swachh Bharat Mission - Principia Scientific - 25th September 2023)
Vaccines only tinker around the edges of a vast complex that is still poorly understood and mainly unknown. A little knowledge is a dangerous thing and it is destroying our immune systems. (Class switch toward non-inflammatory, spike-specific IgG4 antibodies after repeated SARS-CoV-2 mRNA vaccination - ScienceImmunology - 22nd December 2022) (Assessment of inactivated Influenza-A Vaccine after 3 outbreaks of Influenza A at Christ's Hospital - The Lancet - 6th January 1979) (Antibody feedback regulates immune memory after SARS-CoV-2 mRNA vaccination - Nature - 6th December 2022) (IgG4, CD4s and why the LNP/mRNA platform should be prohibited - Unacceptable Jessica - Substack - 14th August 2023)
Vaccine induced artificial immunity is not passed down the generations and is not passed well from mother to infants – so you do not get the protection of herd immunity from vaccines in the same way as with natural immunity. This means that infants are left far more susceptible to disease in the first few years of life because the mother has no real immunity and is relying on artificial immunity, which wanes quickly and is not passed on to the child. (vaccine immunity) (Durability of immune responses to the BNT162b2 mRNA vaccine - BiorXiv 30th September 2021) (Evolution of Antibody Immunity - Nature) - (Necessity of COVID-19 vaccination in previously infected individuals - medRxiv) (SARS-COV-2 specific plasma cells are not durably established in the bone marrow long-lived compartment after mRNA vaccination - Nature Medicine - 27th September 2024)
Vaccines force the immune system to go into inflammatory response but not in the proper manner – so the inflammatory response can remain unabated – confusing the immune system and making the person much more susceptible to other strains and other diseases. Vaccines dysregulate the immune system and weaken it to varying degrees. They can also interfere with our ability to mount an appropriate immune response and they can make us more susceptible to other strains and types of diseases - a phenomenon called virus interference. (Wolff GG. Influenza vaccination and respiratory virus interference) (See link here: PMC article Seasonal Influenza Vaccination and heightened risk of other virus infections)
(Infection-enhancing anti-SARS-Cov-2 antibodies recognise both the original Wuhan/D614G strain and Delta variants. A potential risk for mass vaccination? - Journal of infection) (Synaptic pruning by microglia is necessary for normal brain development - PubMed - 9th September 2011)
(Natural IgG Anti-F (ab')2 Autoantibody Activity in Children with Autism - PubMed - 27th February 2023) (IgG4 Antibodies Induced by Repeated Vaccination May Generate Immune Tolerance to the SARS-CoV-2 Spike Protein - MDPI - 17th May 2023)
Live vaccine viruses also shed. Live viral vaccines like MMR are known to cause outbreaks in people recently vaccinated and others around them.
During mass vaccination campaigns before school – college – university starts we introduce live virus vaccine disease into the population and then get surprised when the majority come down with Measles or Mumps - whether vaccinated or not. Research has shown that the majority who get the diseases have been vaccinated. The majority of outbreaks now are created by mutated, highly virulent virus strains from the vaccines - not the wild strains, many of which were comparatively milder and gave life-long immunity and other health benefits eg protection against cancers.
In this 1 dimensional simplified view of the world – vaccines are touted to be able to wipe out diseases completely. Whole nations are expected to be measles and mumps free – the WHO even gave out measles free status and polio free status to some countries - then had to retract it almost immediately afterwards. Its impossible to be disease free – the world doesn’t work that way – life doesn’t work that way, bacteria and viruses will always find a way to survive – by continually evolving. That’s like saying you are going to stop the world turning or hold the tide back.
How could we ever become disease free – especially when we are continually introducing disease to the populations through the vaccines and everyone is shedding it all around. Complete fantasy – wrong world view. ( Imperfect Vaccination Can Enhance the Transmission of Highly Virulent Pathogens - Plos Biology) (Antibody-dependent enhancement and SARS-CoV-2 vaccines and therapies - Nature microbiology)
(Immune imprinting, breadth of variant recognition, and germinal center response in human SARS-CoV-2 infection and vaccination) - Elsevier - 17th March 2022) (Measles: Unvaccinated Not to Blame for Outbreaks + Other Fun Facts - The Defender - 28th July 2023)
In order to make vaccines you need the diseases themselves – a ready supply of disease bacteria and viruses and toxins - and you need to grow and produce them in live cells or they will die or decay. So you need a large and ready supply of diseases – to make vaccines available to everyone. Vaccines also need preservatives and immune stimulants and oils and other chemicals to mix them and keep them in suspension.
Anything you inject into the body can and does stimulate antibodies – not just the antibodies you want - but other ones you don’t want eg antibodies against your own proteins - or antibodies against DNA or RNA eg the growth cells in the vaccines. ('It's Not Just Autism': The U.S. Rate of Chronic Disease Has Exploded from 6% in 1968 top 54% in 2006 - Rumble - The Vigilant Fox - 8th January 2022)
(Evolving understandings for the roles of non-coding RNAs in autoimmunity and autoimmune disease - ScienceDirect - 7th November 2022)
(HPV Vaccine Mandate to Attend College - Epoch Health - 21st April 2023)
Vaccines are filled with debris from the manufacturing process – a vaccine is not just a Vial with a bit of weakened disease and some saline. Its full of all sorts of things the Immune system may respond to with antibodies. Not only are there weakened live diseases and dead disease products and proteins: some vaccines (Flu vaccines) contain Mercury (preservative) in variable amounts and Aluminium (immune stimulator) in variable amounts. (Expert on Aluminum Toxicity Forced Out of University - Epoch Health - 25th November 2022) They also contain debris from the manufacturing process such as metals and debris from the cells the diseases were grown in –strands of DNA and RNA and proteins and viruses from the Human – Animal and Insect cells that we grow our vaccine disease strains on. (The Vaccine Industry's Dirty Secret - Principia Scientific - 17th January 2023) (Merck's dirty little secret. Vaccines and aluminum history you are not supposed to know - Dr. Susanne Humphries - 23rd April 2022)
Vaccines are full of debris that should not be there. Anyone injected with it will not only make antibodies to the disease - but will also usually make antibodies to the components of the debris. (Toxic pollutants in vaccines: Dr. Montanari and Dr. Gatti - Corvelva)
(Bombshell - Corvelva Releases Next Vaccine Analysis Results - Real News Australia - 23rd December 2018)
(Microscopy of contamination in 44 types of vaccines - International Journal of Vaccines & Vaccination)
(Shocking Lab Investigation of COVID Vaccines - Epoch Health - 1st January 2023) (Would you like Plasmids with that? - Arkmedic - 17th October 2024)
Oils for emulsion of vaccines can induce fatal allergies. Eg peanut oil – seed oils – fish oils – plant oils. Both Mercury and Aluminium are nerve poisons (neurotoxins) they destroy nerves – especially nerve cells – brain cells and the coatings of the nerves eg myelin sheaths and glial cells. This can cause severe nerve damage and autoimmune diseases eg Multiple sclerosis, Motor Neurone Disease, Transverse Myelitis and Guillian Barre syndrome etc.. (COVID-19 mRNA vaccination leading to CNS inflammation: a case series - Journal of Neurology - 4th September 2021) (UK Babies Were Knowingly Given Toxic Vaccines 14x Stronger Than Intended By GlaxoSmithKline in the 60s/70s - Substack - Inversionism - 16th August 2023)
(The Increasing Prevalence of Autoimmunity and Autoimmune Diseases; An Urgent Call to Action for Improved Understanding, Diagnosis, Treatment and Prevention - PubMed - February 2023) (Time trends in the epidemiology of food allergy in England: an observational analysis of Clinical Practice Research Datalink data - the Lancet - September 2024)
DNA and RNA is universal – that means all living things use the same code. So the fragments of DNA and RNA in the debris of the vaccines contain the exact same bases (ATCG components) as our own DNA and RNA. So if antibodies are made against these strands after a vaccine - then the person’s immune system will begin to attack itself. (Autoimmune disease). (Genome-wide, integrative analysis implicates microRNA dysregulation in autism spectrum disorder - Nature Neuroscience - 29th August 2016) (Nuclear permeability during cell division - Anandamide - Substack - 5th June 2023) (Evolving understandings for the roles of non-coding RNAs in autoimmunity and autoimmune disease - ScienceDirect - 7th November 2022)
(Sequencing of bivalent Moderna and Pfizer mRNA vaccines reveals nanogram to microgram quantitiies of expression vactor dsDNA per dose - OSFPreprints - 10th April 2023) (Vaccination and multiple sclerosis - Dr. John Campbell - YouTube - May 2023)
Functional Neurological Disorder (FND) is a term now used to explain neurological symptoms seen after vaccinations. There have been many incidences of FND world-wide - from many different vaccines (eg HPV & Flu). These types of symptoms may be dismissed by health professionals in the first instance as all due to stress and to psychological factors. (Functional Neurological Disorder After SARS-CoV-2 Vaccines: Two Case Reports and Discussion of Potential Public Health Implications - Neuropsychiatry - 15th July 2021) (Novel Movement Disorders After COVID Vaccination: Patients Misdiagnosed, Treatment Delayed - Epoch Health - 2nd May 2023)
(Functional neurologic disorder associated with SARS-CoV-2 vaccination - PubMed - 15th August 2022)
(Long COVID Is Not a Functional Neurologic Disorder - MDPI - 29th July 2024)
Molecular mimicry also causes the immune system to attack itself - if components of the vaccines are not strictly checked for molecular mimicry (similarity or the same as human body components) - if they are similar to or mimic the bodies own components this can cause untold amounts of permanent damage to health and to the immune system - leading to some of the worst autoimmune diseases. eg Thrombocytopenia, Multiple Sclerosis - Lupus - POTS - Transverse Myeltis - Guillain Barre - ALS - Rheumatoid Arthritis - CVST - VITT - FND - Motor Neurone Disease etc.
Auto-antibodies can be made (permanently) by the persons own immune system after it has been dysregulated and damaged by molecular mimicry, resulting in a vast range of severe neurological diseases. (Reports of Guillain-Barre Syndrome After COVID-19 Vaccination in the United States - JAMA- 1st February 2023) (Molecular mimicry between SARS-CoV-2 and the female reproductive system - PubMed - 8th December 2021)
(Covid-19 and autoimmunity - PubMed - 11th June 2020) (COVID vaccines have likely caused over 25,000 new cases of multiple sclerosis (MS) - Steve Kirch - Substack - 29th May 2023) (Immune Dysregulation in Autism Spectrum Disorder: What Do We Know about It? - PMC - 11th March 2022) (Severe acute respiratory syndrome coronavirus and viral mimicry - The Lancet - 14th June 2003) ( COVID-19 and molecular mimicry: The Columbus' egg? - Journal of clinical neuroscience - 5th May 2020) (Is COVID-19 a proteiform disease inducing also molecular mimicry phenomena? - SpringerLink - 20th April 2020) (Nervous system consequences of COVID-19 - Science - 20th January 2022) (Potential Autoimmunity Resulting from Molecular Mimicry between SARS-C0V-2 Spike and Human Proteins - MDPI - 28th June 2022) (The SARS-CoV-2 as an instrumental trigger of autoimmunity - PubMed - 19th February 2021) (No one would ever accept permanent fever...So, why accept permanently high antibodies? Its's a "Death Zone"! - Substack - 30th January 2021) (The Rise of `POTS in the COVID-19 and Vaccine Era - Epoch Health - 17th July 2023)
(The Potential Role of SARS-CoV-2 Infection and Vaccines in Multiple Sclerosis Onset and Reactivation: A Case Series and Literature Review - PubMed - 18th July 2023) (Molecular mimicry between SARS-C0V-2 spikeglycoprotein and mammalian proteomes: implications for the vaccine - PubMed Central - 18th September 2020) (Postural orthostatic tachycardia syndrome as a sequela of COVID-19 - PubMed - 16th July 2022) (Apparent risks of postural orthostatic tachycardia syndrome diagnoses after COVID-19 vaccination and SARS-Cov-2 Infection - Nature - 12th December 2022)
These strands of DNA and RNA from other humans - male DNA/RNA - female DNA/RNA – animals - insects and pathogens can also become incorporated into our DNA and compromise our genomes in unknown/unresearched ways - they can cause genetic mutations - genetic alterations - misreading of genes - changes to gene expression and alien proteins to be made. Recent research shows that these changes to our genes can be passed down through the generations to our offspring with unknown consequences for humanity. (Nuclear translocation of spike mRNA and protein is a novel pathogenic feature of SARS-CoV-2 - BioRxiv - 27th September 2022) (Sars-CoV-2 RNA reverse-transcribed and integrated into the human genome) (mRNAs as biomarkers of autism spectrum disorder: a sytematic review and meta-analysis - Springer - 3rd February 2023)
(Reverse-transcribed SARS-CoV RNA can integrate into the genome of cultured human cells and can be expressed in patient-derived tissues - PNAS)
(Intracelular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 in Vitro in Human Liver Cell Line - MDPI - 25th February 2022) (Potential Mechanisms for Human Genome Integraton of Genetic Code from SARS-CoV-2 mRNA Vaccination - ResearchGate - November 2022) (Spontaneous Integraton of Human DNA Fragments in Host Genome - Sound Choice Pharmaceutical Institiute - T.A.Deisher)
(5 ways to skin a (genetically modified) cat - Substack - Dr Ah Kahn Syed - 1st October 2023) (SV40 origin of replication in mamalian cells in absence of SV40 Large T-Antigen - Anandamide - 14th October 2024)
Antibodies to cell proteins from the cells we grow the vaccines on – will also trigger our immune system to attack its own proteins (autoantibodies). There are also dangerous retroviruses and stray - monkey - dog - insect viruses and other diseases, in the human - animal and insect cells that we produce the vaccines in - which can be passed on to the vaccinated. (eg swine flu and bird flu viruses).
It is a dangerous lottery - what you get from the end of that needle - and how your particular immune system will react to it. But one thing we know –
if you inject the debris in vaccines – antibodies will be made – and not just the ones you want.
When you agree to vaccination you are playing Russian Roulette with your health and your children’s health. Think deeply and do the research very carefully – the real research is out there. The world is not as simple as the vaccine pushers would have you believe. (Undeniable Death Cases After HPV Vaccination - Epoch Health - 25th June 2023)
(BNT162b2 COVID-19 vaccination in children alters cytokine responses to heterologous pathogens and Toll-like receptor agonists - Frontiers - 25th August 2023) (COVID-19 vaccines immediate onset Autoimmune Disease adverse events in VAERS - Darrell O. Ricke, M.S.,PHD - 17th October 2023) (New-Onset Rheumatic Immune-Mediated Inflammatory Diseases Following SARS-CoV-2 Vaccinations until May 2023: Asystematic Review - MDPI 11th October 2023)
You may ask why would Vaccinologists – Immunologists - Scientists - Doctors - Health Authorities and Governments allow us to be injected with dangerous substances? The answer is why do they ever allow and promote any dangerous substance – drug or practice. If you look at history up to recent times you get your answer. Why did the same Health boards, Doctors and Scientists – allow contaminated blood products (eg Factor 8) to be given to haemophiliacs for decades after they knew that it would give thousands of people Aids and Hepatitis C. Why did they allow thousands of people to die and thousands more to become permanently sick? Because they can - People believe in them (Authority figures). People have faith in them. Blind faith. (SARS-CoV-2 Spike Protein Accumulation in the Skull-Meninges-Brain Axis: Potential Implication for Long-Term Neurological Complications in post-COVID-19 - BioRxiv - 4th April 2023)
These people don’t want to change their policies or to be seen to be wrong - ever. Once they decide on something or some policy they will fight tooth and nail to protect their decision. No matter how wrong it is – no matter how many people it kills. No matter how much scientific evidence to the contrary has been presented to them. Even if new information comes up that completely negates their policies and decisions they will ignore it – cover it up and deny – deny –deny - while people die. They are so pathologically enmeshed in their own 1 dimensional belief systems - careers – big egos – salaries – hefty bribes - prestige – reputation – hierarchical positions in society.
They are so way down the road of their own decisions and beliefs - that the truth begins not to matter to them - and other people become collateral damage. When their reputation and position in society is at stake – they lie – cover –up and hide the truth for as long as they can. Who will be finally responsible anyway? Certainly not them - Years from now – money will be paid out to victims but no-one will be called to account. We will pay out vast sums of taxpayer’s money to the injured and the maimed – but never change how it happened in the first place.
Do your research – if something is disputed by many – there is something to be explored. (Scientific Review of Vaccine Safety Datalink Information - Simpsonwood Documents June 2000) (Reaffirming a Positive Correlation Between Number of Vaccine Doses and Infant Mortality Rates: A Response to Critics - Cureus - 2nd February 2023) (CDC Reports: More than 1 in 10 Boys Have ID, ASD, or Another Developmental Delay - Safe Minds - 17th July 2023) (Kevan McKernan Talks COVID Vaccine DNA Contamination, the Monkey Virus SV40 Promoter, and What's Actually in the Vaccines - EpochTV - 29th August 2023) (The contaminated blood scandal - The Haemophilia Society - 2024) (Infected Blood Inquiry finds multiple failures - The Haemophilia Society - 20th May 2024)
Don’t close your ears and eyes and brain and look the other way. Don’t be comfortable and lazy believing the majority – find out for yourself if the majority are right. Very often what the majority believe is the easy comfortable lie. We believe it because everyone else believes it but no-body has really bothered to check it out - except a minority and they are ridiculed by us. It is always the minority that change the status quo and mostly for the betterment of society. (What are the risks and benefit of each vaccine? - A Midwestern Doctor - Substack - 5th April 2023)
Listen to the other side of the argument. In this world nothing is simple and nothing is completely known. No matter how vehemently the 1 dimensional believers shout that vaccines are safe and effective and the science is settled. Science is never settled – nothing is ever completely settled in this world. At any point a discovery will uncover something we knew nothing about - a discovery that changes our world and makes us see it in a different way. A discovery that makes the old ways obsolete. It happens all the time. Read an old science book – new discoveries make some of it completely wrong. Recently scientists discovered that the brain has its own immune system – we didn’t know – we hadn’t seen the structure. Our beliefs about the brain and immune system had to change because of it and are still changing. (Natural immunity lasts for at least 100 years - Substack - Dr. Paul Alexander 25th November 2023)
Do not fall for the 1 dimensional simplified propaganda – we don’t know all there is to know and probably never will. If it sounds simple and easy – it’s probably wrong. Don’t just line up for your vaccines and let your health be taken care of by strangers. Take care of your own health as much as possible. Millions fall for that line every day. Research and ask around – listen to both sides of every issue. Don’t take things on trust from the sources: that history confirms are not trustworthy. Think of smokers who were told by doctors and governments and media that cigarettes were good for their health. Think of Thalidomide – Di-ethyl Stilbestrol (DES) - DDT – Vioxx – Fentanyl - Factor 8 blood products – Opioid medicines dished out like sweets – Round up - carcinogenic weedkillers - Aspartame - Fluoride - SSRIs and Vaccines eg Anthrax and Swine Flu vaccines. (Gulf War Syndrome: Killing Our Own - The Expose - 31st January 2024) (Up to 500,000 Dead from a Headache Pill: These Vaccine Manufacturers Are Serial Felons - RFK Jr. - Rumble - 28th April 2023) (The Untold Purdue Pharma Story CNBC Kept Hidden - Rumble - Vigilant News Network - 11th July 2024)
An example is the Swine Flu vaccines in 2009 were rushed to market - resulting in many children and adults developing permanent lifelong neurological illness, Narcolepsy. (www.narcolepsy.org.uk/resources/pandemrix-narcolepsy). ( Up to 500,000 Dead from a Headache Pill - Rumble - 11th July 2022) (Lessons (Not) Learned From a Vaccination Campaign Catastrophe - Epoch Health - 29th November 2022) (The First Mandatory Vaccination Campaign That Crippled America's Pilots - Robert W Malone - Substack - 16th February 2023) (After Long Silence on 'Long Vax,' Science Magazine Links Autoimmune Disorders to COVID Shots - Epoch Health - 18th July 2023) (Episode 332: The Forbidden Debate - The Highwire - 10th August 2023) ( What Really Happened Inside the COVID-19 Vaccine Trials? - A Midwestern Doctor - Substack - 13th March 2023)
(ICAN - Informed Consent Action Network - Vaccines - No Placebos - icandecide.org - 24th July 2024) (ICAN - informedConsentActionNetwork - Get Informed - August 2024)
Do the research – your life and your children’s lives depend on it.
|
Adverse Reactions to Vaccines Facebook Community Page
has been unpublished by FACEBOOK as of July 16th 2021 We will miss sharing the facts and the truth to our community on that platform. According to recent research - Natural immunity is far superior to vaccination. Natural immunity provides potent long lasting immunity and greater evolution of antibodies over time, with increased neutralising activity and greater breadth of immunity to antigens and variants.
We are now acknowledging some adverse effects after vaccination - this is a major shift which can lead to society actually fully acknowledging and helping people who have been damaged by the jabs. Unexplored biosafety issues with respect to self-amplifying (RdRp) RNA-LNP products - Jessica Rose - 15th November 2024
This article is about RNA recombination and the potential dangers of this happening with regard to injecting self-amplifying RNA-LNP injectable products into mammals, including humans. Cancer Surge After mRNA COVID Vaccines: An Oncologist Speaks Out Dr. Angus Dalgleish - Counterpoint with Eddie Hobbs - 12th November 2024
Professor Angus Dalgleish is a leading UK clinical oncologist, vaccinologist, and immunologist with 40+ years of extensive experience in vaccine development and cancer research. Stunning Revelations in Massive Robert Koch Institute Leak - Courageous Discourse - 9th November 2024
A massive leak of internal e-mails and memos from Germany’s Robert Koch Institute (federal agency and research institute for controlling infectious disease) reveals that the institute's scientists understood that virtually every aspect of the COVID-19 pandemic response was NOT guided by science, but by political machinations to spread fear, control the population, and promote the experimental vaccines. Letter to Dads - Graham Brownstein -1st November 2024
I am writing this to my fellow dads for one reason: to convince you to stop pushing for your children to be injected with vaccines. Whatever you think you are doing, the tragic truth is that you are maiming, sterilizing and killing your kids. You are decimating your family line. Please stop before it is too late. UK surgeon describes new aggressive cancers with a different biology after rollout of covid injections - The Expose - 26th October 2024
Mr. James Royle who is a consultant NHS surgeon described what he and his team have been witnessing since the mass covid injection campaign began. “Cancers being observed are in all ages. It is my assertion, shared by many expert oncologists and clinical colleagues around the world, that the cancers we are seeing are extremely aggressive and they are of a different biology,” he said. And it’s not only new aggressive cancers and rare cancers becoming more frequent. Back To Basics Conference - Anandamide - 25th October 2024
The regulators are using a single qPCR assay in the Kan gene. We have shown that many of these lots (not all and we don’t understand why) have a 6CT offset if you use 2 different qPCR assays. 60 Billion Oops - Anandamide - 23rd October 2024
What's a little Somatic Hyper Mutation-targeting element amongst friends? So the SV40 Enhancer that Pfizer injected into billions of people without consent at 60 Billion copies per dose is a little mutation factory. It recruits a cytosine deaminase AID which is part of the APOBEC pathway. The HPV Vaccine Tragedy Was A Test Run For COVID-19 - A Midwestern Doctor - 22nd October 2024A review of the incredible dangers of the HPV vaccine and the unscrupulous campaign that forced it upon the world
TGA rejects concerns over DNA fragments found in mRNA vaccines - Maryanne Demasi, PHD - 19th October 2024
After an article about the discovery of residual DNA in the Gardasil HPV vaccine, and multiple calls this month for the Prime Minister to “immediately suspend” the covid-19 mRNA vaccines, the Australian drug regulator has responded. The Therapeutic Goods Administration (TGA) released a statement “addressing misinformation about excessive DNA in the mRNA vaccines.” Would you like Plasmids with that? - Arkmedic - 17th October 2024
Plasmids are DNA sequences used by laboratories to manufacture vaccines and biologics and contain elements that should never get to the human supply chain. It turns out that this has been happening for decades, discovered following independent investigation into the COVID vaccines. Revelations this week implicate every recombinant vaccine currently in use, in this major contamination scandal. SV40 origin of replication in mammalian cells in absence of SV40 Large T-Antigen - Anandamide - 14th October 2024
Positive tumor biopsy qPCR one year after vaccination We’ve previously described BNT162b2 transfected OVCAR3 cell lines showing evidence of BNT162b2 plasmid DNA replication. This is perplexing as SV40 origins of replication usually require SV40 Large Tumor-Antigen to replicate in mammalian cells and Pfizer vaccines do not contain SV40 Large T-Antigen. Major Study of 1.7 Million Children Finds Myocarditis Only in Kids Given COVID-19 Vaccines - Reform Pharma - 11th October 2024
Since the authorization of COVID-19 vaccines for children and adolescents in 2021, health officials have reassured the public that vaccine-related heart inflammation—myocarditis and pericarditis—is rare and claimed children were at a higher risk of developing myocarditis from the virus. Now they're going for microRNAs - Jessica Rose - 9th October 2024
"MicroRNAs (miRNAs) are small, non-coding RNA regulatory molecules that play critical roles in post-transcriptional regulation of gene expression. They bind complementary sequences in messenger RNA thus messing with translation and protein production. miRNAs are approximately 21-23 nucleotides in length and are found in plants, animals, and some viruses." Gut Autoimmunity via Spike: The Calm Before the Pathogenic Priming Storm? - James Lyons-Weiler - 2nd October 2024
As the COVID-19 pandemic unfolded, researchers identified troubling links between SARS-CoV-2, its spike protein, and the triggering of autoimmune diseases—a phenomenon called pathogenic priming, first brought to attention by Lyons-Weiler (2020). Inadvertent Exposure to Pharmacologically Designed Lipid Nanoparticles Via Bodily Fluids: Biologic Plausibility and Potential Consequences - Clinical Research - 1st October 2024
"Exposure to lipid nanoparticles, modified mRNA, adenoviral DNA, and/or spike protein from a Covid-19 injectable product or through secondary exposure via blood transfusion, is a potential source of human physiological harm." COVID-19 Vaccine Limited Immunity Durability Was Knowable from the Start: No Long-Lived Plasma Cells - James Lyons-Weiler - 28th September 2024
"Recent research has confirmed that one critical piece of the puzzle—long-lived plasma cells (LLPCs)—is missing from the immune response generated by mRNA vaccines, raising questions about whether the limitations of these vaccines were knowable from the start." All about compendial standard non-adherence and self-amplifying RNA-LNP tech dangers - Jessica Rose - 20th September 2024
"Problems and Harms Associated with Novel LNP-Based Prophylactic Injection Methodologies" New Science Shows MRNA Jabs Weaken The Immune System - The Highwire - 19th September 2024
Research is piling up to reveal that the mRNA vaccines increasingly weaken the immune system with each booster. Jefferey dives deeper into what “HighWire” guests Bret Weinstein, PhD and William Makis, MD both detail – multiple vaccinations causing a class switch in antibody production to an overproduction of IgG4, the antibody responsible for dampening immune response, and underproduction of IgG1 and IgG3, the antibodies responsible for cancer surveillance. Salt can boost antitumor responses of T cells - Medical News - 13th September 2024
"The findings indicated that sodium is a relevant component of the tumor microenvironment. NaCl increased cytotoxic T-cell activation and activity, which improved metabolic fitness. Thus, NaCl enhances tumor cell death in vitro and in vivo." Tell the USDAS to Keep Livestock Vaccine Trials in the LAB & Out of Our Food - Organic Consumer Association - 11th September 2024Agriculture Secretary Tom Vilsack is conducting field trials of bird flu vaccines for dairy cows.
On August 28, 2024, his Center for Veterinary Biologics announced a huge change to the way the U.S. Department of Agriculture tests new livestock vaccines. It used to be that livestock vaccine studies were only conducted in laboratories. Now, for the first time ever, vaccine studies are happening “outside of containment without terminal disposal of milk and other commodities.” In other words, the vaccine “trial” is happening on commercial farms and the milk is going right into the food supply! The Bird Flu Vaccine Clinical Trials - Aaron Siri - 11th September 2024
ird flu is all the rage. As this issue heats up, here is a bit of information about each of the three bird flu (H5N1) vaccines licensed by the FDA.First is Sanofi (National Stockpile), which was licensed for adults based on a clinical trial in which only 103 adults were vaccinated and 48 received the placebo. Worse, there were four serious adverse events in the vaccine group. Why we can't move forward with self-amplifying RNA technology - Jessica Rose - 7th September 2024
Everybody knows that the COVID-19 shots are associated with harms. We know this from pharmacovigilance and hospital data, peer-reviewed studies and on-the-ground reports of everything from cancer to autoimmune conditions. The exact mechanism of action of harm has yet to be definitively defined, but we do know that the harms are comprehensive and this points to immune system dysfunction. International scientists have found autism's cause. What will Americans do? - J.B. Handley - 2nd September 2024
STAFFORDSHIRE, England —Dr. Chris Exley of Keele University in England and his colleagues published a paper that for the first time ever looked at the brain tissue of subjects with autism to determine the level of aluminum (note: they spell “aluminum” as “aluminium” in the United Kingdom) found within their brain tissue. For anyone trying to convince the world that “the science is settled and vaccines don’t cause autism,” the study’s findings are deeply contradictory to that statement. Time trends in the epidemiology of food allergy in England: an observational analysis of Clinical Practice Research Datalink data - The Lancet - September 2024
"Estimated incidence of probable food allergy doubled between 2008 and 2018, from 75·8 individuals per 100 000 person-years (95% CI 73·7–77·9) in 2008 to 159·5 (156·6–162·3) individuals per 100 000 person-years in 2018." "These estimates indicate an important and increasing burden of food allergy in England." The Role of Mitochondrial Function in Autoimmune Diseases - Mercola - 19th August 2024
"Autoimmune diseases affect an estimated 50 million Americans, making them the third most common disease category, behind only cancer and heart disease. Close to 80% of those affected are women, and autoimmune diseases represent a leading cause of death among young and middle-aged women." Nasty 'Anti-Vax' Statements About the MMR Vaccine - Dr. Byram Bridle - 16th August 2024
If anyone, including immunologists specializing in the sub-discipline of vaccinology, said anything of concern about the COVID-19 vaccine narrative, they were immediately labeled an ‘antivaxxer’; regardless of how much primary scientific data they used to elevate their concerns. So, I am predicting that a lot of people are going to be tempted to throw around the ‘antivax’ label after they see the facts that I am about to disclose… This is getting embarrassing for the WHO, me thinks - Jessica Rose - 15th August 2024
"The so-called increase in death rate being propagated by strange unelected individuals with investments to protect involves absolutely negligible numbers - and that’s assuming even these numbers aren’t fabricated. WHO knows, at this point. Public distrust is at an all-time high due to the COVID-19 “mismanagement debacle”." Eye issues skyrocket after the COVID shots rolled out - Steve Kirsch - 15th August 2024
I screen grabbed this image during a recent conference call. H28 is essentially the ICD-code for cataracts. This is not a statistical anomaly. This was caused by something. This is not caused by people who weren’t able to take their cataract medicine during the lockdowns because there is no such thing as cataract medicine. The only thing I can think of that would be capable of causing a massive change like this is the COVID jabs. The Right to Think for Yourself - Robert Malone - 5th August 2024
Our minds and our speech are what make us uniquely human. Our ability to conceive and communicate our personal view of the world around us is a central aspect of ourselves and of our person. To compromise or limit the ability of an individual to exercise freedom of thought and speech is to make that individual less human. Why Was Moderna Allowed to Use A Toxic mRNA Dose? - A Midwestern Doctor - 4th August 2024
One of the major problems facing mRNA technology was finding a dose that was strong enough to elicit the desired effect but simultaneously not unbearably toxic. Moderna in turn chose a dose that was 3.3X greater than what even Pfizer felt was safe enough to use. 'Blood Distribution of SARS-CoV-2 Lipid Nanoparticle mRNA Vaccine in Humans" - Jessica Rose - 3rd August 2024
A new preprint hit the presses on July 27, 2024. It was written by a group out of Australia and describes experiments that they did to show that the lipid nanoparticles used in the Moderna COVID-19 injectable products stick around and circulate on the blood. Shocker. They describe how so-called ‘anti-vector responses’ - such as the production of anti-PEG antibodies in the case of the modified mRNA lipid nanoparticle (LNP)-based injectable products - can be potent effectors in an immune response; be it beneficial, or not. As the authors point out, the long-term effects of boosting anti-PEG antibodies is not known. High serum prevalence of autoreactive IgG antibodies against peripheral nerve structures in patients with neurological post-COVID-19 vaccination syndrome - Frontiers - 2nd August 2024
Conclusion: Our data suggest that autoantibodies against nervous system tissue could be relevant in PCVS patients. Autoantibodies against neurofilaments and cell nuclei with so far non-established links to this disease spectrum should be further elucidated to determine their biomarker potential. Compelling Theory Describes How Notorious Covid Vaccine 'White, Fibrous Clots' Form In The Body - Rumble - Sunfellow On COVID-19 - 24th July 2024WOW! Very compelling theory describes how the notorious "white, fibrous clots" form in the body.
Polymer chemist Greg Harrison outlines the theory on an episode of Tony Lohnes' (@sundayshopping) podcast, noting that Mike Adams' (@HealthRanger) analysis of the white fibrous clots, which went viral in 2022, surprised him, due in large part to the abundance of the element phosphorus. While working on the Czech Republic data I went blind in my right eye - Steve Kirsch - 24th July 2024
Nearly all the vision is gone in my right eye. I wasn’t doing anything special, just computing MRR’s on the Czech Republic data that I've written abot before using the time-series data I enhanced to count by brand. The Spike Protein and Systemic Prion Disease: RBD Prion-Like Domain/Mitochondrial Interactions Induce a Novel Form - WMC Research - 22nd July 2024
From infection to gene therapy, the Spike Protein fills organs with non-functioning aggregates. "No Known Cure" - Vaccine Injured: The Battle Against Big Pharma and the Government - PBD Podcast - 20th July 2024
Patrick Bet-David hears the personal experiences of Brianne Dressen and Kyle Warner. Brianne had to put motherhood aside due to the debilitating side effects of the vaccine on her body. Kyle Warner had to end his career as a professional cyclist due to the risk of his heart stopping. In this uncensored interview, they tell PBD about their ongoing battle with pharmaceutical companies, government agencies, and their own bodies. My 5C rebuttal of the 5C model of vaccine hesitancy - Jessica Rose - 19th July 2024
He said that it triggered a nerve in him. You could say that it did the same to me. It also inspired me to respond in kind in the following way. A protection against bioweapons - VDJ recombination explained - Dr. Kevin Stillwagon - Substack - 14th July 2024
The human immune system is a marvel of biological engineering, designed to protect us from a vast array of potential threats, including viruses, bacteria, and even man-made bioweapons. God designed the human body to be able to do this from birth, and if we could not do this, we would not be able to survive as a species. Functional implications of the interaction of the SARS-CoV-2 Nucleocapsid protein with factors involved in nonsense-mediated mRNA decay - BioRxiv - 16th July 2024
A high throughput analysis of interactions between human and SARS-CoV-2 proteins identified multiple interactions of the structural Nucleocapsid (N) protein with RNA processing factors. The N-protein, which is responsible for packaging of the viral genomic RNA was found to interact with two RNA helicases, UPF1 and MOV10 that are involved in nonsense-mediated mRNA decay (NMD). Experts Concede Vaccine Safety is Unfunded and Inadequate - The Highwire - 11th July 2024
Del breaks down a recent article in the New England Journal of Medicine co-authored by Stanley Plotkin, the ‘godfather of vaccines,’ littered with admissions regarding the lack of safety studies related to vaccine safety. This monumental paper concedes many of the issues that The HighWire and the Informed Consent Action Network have been fighting for in court. And Like That, The Claim Vaccines Are The World's Best Studied Product Dies - Substack - Aaron Siri - 10th July 2024
The world’s leading vaccinologist, Dr. Stanley Plotkin, and company have just capitulated…Wow. After decades of Dr. Stanley Plotkin and his vaccinologist disciples insisting vaccines are the most well studied products on the planet, they just penned an article admitting precisely the opposite. Dr. James Thorp Describes The Horrific Damage COVID Vaccines Have Done To Mothers & Babies - Rumble - Sunfellow On COVID-19 - 10th July 2024
OBGYN with 43 years of experience @jathorpmfm explains the devastating consequences of COVID vaccination: "I don't know if there is any other physician in the country that sees as many patients as I do by ultrasound, so I know what's going on. I've seen death and destruction like I've never seen before. "There is a 1200x increase in menstrual abnormalities. "When we look at pregnancy, there is a substantial and significant increase in miscarriages, birth defects, fetal cardiac arrhythmia, fetal cardiac malformations, fetal growth slowing, reduction in amniotic fluid and fetal cardiac arrest." "'Are you saying that babies are having heart attacks in the womb?'" "Yes. The vaccine is causing a significant inflammatory effect." How Vaccines Change Our Immune Systems - Rumble - Your Health. Your Story - 8th July 2024
If vaccines are administered to improve our health, then why is America one of the sickest nations on earth? Dr. Lawrence Palevsky examines the long-term impact of vaccines and over-vaccination, and explains why the exploding rate of allergies, autoimmune conditions, and chronic illnesses is not the mystery the medical community claims it is. Coming soon to an arm near you - an mRNA jab for covid AND flu - The Conservative Woman - 8th July 2024
IF REPEATEDLY doing the same thing and expecting a different result is the definition of madness, the world of public health continues to show signs of insanity. According to Nature a new mRNA combined flu and covid jab is on the way. Reviewing "Persistent Vascular Complications in Long COVID: The Role of ACE2 Deactivation, Microclots, and Uniform Fibrosis" - WMC Research - 4th July 2024
Published last week, the most convincing evidence to date supporting my SPED (Spike Protein Endothelial Disease) hypothesis. New RSV mRNA trial recruiting babies for "investigational vaccines" - YouTube - Dr Philip Bosanquet - 4th July 2024
5-7 month old babies are being recruited for the Rhyme trial to test new “investigational vaccines” called mRNA-1345 and mRNA-1365. The viruses being targeted by Moderna are RSV (respiratory syncytial virus) and hMPV (human metapneumovirus). Is focusing efforts on developing new pharmaceutical agents the ticket to better resilience against infectious disease and better health? Or should the focus of attention be lifestyle changes including key aspects such as improving nutrition? What is the most effective path to better health? I’d love to hear your thoughts. Door to Freedom's weekly newsletter is on the facts about H5N1 bird flu - Substack - Meryl Nass - 4th July 2024
Why governments may be making an inordinate fuss about it. Protecting yourself from the coming vaccines. No more COVID redux. Sign up at doortofreedom.org for email copies or to share. A Critical Analysis of All-Cause Deaths During COVID-19 Vaccination in an Italian Province - MDPI - 30th June 2024
The all-cause-death hazard ratios in univariate analysis for vaccinated people with 1, 2, and 3/4 doses versus unvaccinated people were 0.88, 1.23, and 1.21, respectively. The multivariate values were 2.40, 1.98, and 0.99. Kansas Attorney General Report - Carl Heneghan - Trust the Evidence - 27th June
We’ve extracted the main points from the Kansas City Attorney General’s legal report on the case against Pfizer that we first mentioned in Due Process—all quotes are taken verbatim. Persistent Vascular Complications in Long COVID: The Role of ACE2 Deactivation, Microclots and Uniform Fibrosis - MDPI - 27th June 2024
"The persistence of these microclots and the unique fibrosis pattern are suggested as key factors in the extended duration of vascular complications post-COVID-19 infection, regardless of the initial disease severity. Moreover, plasma ACE2 activity has the potential to serve as prognostic or diagnostic biomarkers for monitoring disease severity and managing long COVID symptoms. Elucidating the role of ACE2 deactivation and the consequent events is vital for understanding the long-term effects of COVID-19." COVID-19 Vaccines: A Risk Factor for Cerebral Thrombotic Syndromes - Preprints.org - 19th June 2024
Conclusions: There is an alarming breach in the safety signal threshold concerning cerebral thrombosis AEs after COVID-19 vaccines compared to that of the influenza vaccines and even when compared to that of all other vaccines. An immediate global moratorium on the use of COVID-19 vaccines is necessary with an absolute contraindication in women of reproductive age. An open letter to Professor MacEwen at the GMC - Hartgroup.org - 27th June 2024
time to put your words into practice and end the witch hunt against doctors We are writing to you now to urge the GMC to apply the same protection to whistleblowers reporting Covid vaccine harms that you have rightly observed were missing decades ago in the contaminated blood scandal. We urge you to call a moratorium on all GMC investigations which do not arise directly from complaints about actual patient care. 1/200 chance of death in context of new bird flu injection - 5 times higher than placebo according to clinical trial - Jessica Rose - 27th June 2024
Clinical Trial NCT02839330 tested the H5N1 Subunit Influenza Virus Vaccine “Fatal SAEs included 11 (0.5%) AUDENZ recipients and 1 (0.1%) placebo recipients.” Over 100M Americans think the COVID-19 Vaccine 'Is Killing Large Numbers of People' - Steve Kirsch - 26th June 2024
And 66M Americans have "buyer's remorse." Also, new studies published in medical journals now show that mRNA shots cause permanent brain damage. Supreme Court Missouri v. Biden. Bird flu. Are There Vaccines in our Food Supply? - Brownstone Institute - 24th June 2024
"Before any vaccine technology is used on humans, it is usually tried in the veterinary market first due to the incredibly lax regulations. Knowing this, it should come as no surprise that our food animals had been receiving mRNA injections for years before the Covid vaccine rollout." Upregulation of Neuroinflammation-Associated Genes in the Brain of SARS-CoV-2 -Infected Mice - MDPI - 22nd June 2024
We found that genes upregulated at day 6 post-infection were mainly associated with Toll-like receptor (TLR) signaling, RIG-I-like receptor (RLR) signaling, and cell death pathways. However, downregulated genes were associated with neurodegeneration and synaptic signaling pathways. In correlation with gene expression profiles, a multiplexed immunoassay showed the upregulation of multiple cytokines and chemokines involved in inflammation and cell death in SARS-CoV-2-infected brains. A systematic REVIEW of Autopsy findings in deaths after covid-19 vaccination - ScienceDirect - 21st June 2024
We found that 73.9% of deaths were directly due to or significantly contributed to by COVID-19 vaccination. Our data suggest a high likelihood of a causal link between COVID-19 vaccination and death. These findings indicate the urgent need to elucidate the pathophysiologic mechanisms of death with the goal of risk stratification and avoidance of death for the large numbers of individuals who have taken or will receive one or more COVID-19 vaccines in the future. Infants Who Receive Multiple Vaccines at Once at 'Exponentially' Greater Risk of Disease, Developmental Delays - The Defender - 20th June 2024
“If safety signals sounded alarms, the results would be deafening,” said Karl Jablonowski, Ph.D., senior research scientist at Children’s Health Defense (CHD), co-author along with CHD Chief Scientific Officer Brian Hooker, Ph.D., of a study published Wednesday in the International Journal of Vaccine Theory, Practice, and Research." We Now Have Proof The COVID Vaccines Damage Cognition - A Midwestern Doctor - 20th June 2024
Subtle and overt neurological injuries are one of the most common results of a pharmaceutical injury. The COVID-19 vaccines excel at causing damage to cognition, and many of us have noticed both subtle and over cognitive impairment following vaccination that relatively few people know how to address. "Human SARS-CoV-2 challenge uncovers local and systemic response dynamics - Nature - 19th June 2024
"Although this decrease meant that activated T cells were barely detectable at day 28 after inoculation, the associated TCR clonotypes in circulation could still be identified, having transitioned into memory and effector T cells" "We did, however, detect a small increase in the number of activated T cells in the nasopharynx of two out of the three individuals with transient infections (Fig.3c). This result suggests that a smaller T cell response can be established without going through a sustained infection." "Seven participants remained PCR-negative throughout the quarantine period, which indicated that these individuals successfully prevented the onset of a sustained or transient infection. Because these participants all remained seronegative but were observed to display early innate immune responses (see below), we termed these abortive infections (as opposed to uninfected owing to, for example, antibody-mediated sterilizing immunity)." "Our data suggest that HLA-DQA2 expression is indicative of protection against productive SARS-CoV-2 infections, which we confirmed using cross-validation and in our independent validation cohort (Extended Data Fig.6f-h,q). This is, to our knowledge, the first gene expression-derived predictor that is not based on acquired immunological memory." "Our single-cell human SARS-CoV-2 challenge study revealed several new insights (Extended Data Fig.10). We detected multiple response states that precede the onset of clinical manifestations, including the activation of MAIT cells and decrease in inflammatory monocytes. These results represent newly discovered immune responses that emerge when exposure to SARS-CoV-2 does not lead to COVID-19. These monocyte and MAIT responses during very early and abortive infections can be used as biomarkers of an immediate immune response following viral exposure." Psychological Bioterrorism - Substack - Robert W. Malone MD, MS - 15th June 2024
In my opinion, the promoted fear of the current “Avian Influenza” strain is one example of “Disease X,” which the WHO has been warning of. However, “Avian influenza” is not the threat to human health that it is being promoted to be. To the best of my knowledge, there have been no documented human deaths from this version of Bird Flu, and there is no evidence that it is being transmitted from human to human in a regular or sustained fashion. This appears to be another example of “Psychological Bioterrorism”, which is the focus of this lecture. Breaking News: BC Centre for Disease Control Caught Lying and Withholding Important Public Health Data - Substack - Dr. Byram W. Bridle - 14th June 2024
British Columbia Centre for Disease Control Discovered COVID-19 Shots Were More Than Sixteen Times More Dangerous Than Flu Shots But Never Disclosed this Publicly. Double Digits: Biden Admin Tells Americans It's Almost Time for their 10th COVID Shot - VNN - 14th June 2024
The “experts” and bureaucrats on the FDA’s totally-not-compromised-by-Big Pharma vaccine committee have declared that there is a need for a 10th Covid shot in the Fall. Yes, for those who adhere to FDA and CDC recommendations, people who stay true to “the science” will soon roll up their sleeves for a 10th Covid mRNA shot. U.S. Government Studying Possible Respiratory Spread of Bird Flu - Does It Matter? - The Defender - 13th June 2024
"f the virus is airborne, it could evolve faster and pose a greater threat to humans, according to a government researcher who previously conducted gain-of-function research on bird flu. But other experts repeated the CDC’s claim that the virus poses little threat to humans." History, Harms, and Theoretical Benefits of Routine Vaccination in Pregnancy - Substack - Peter A. McCullough, MD, MPH - 11th June 2024
When my children were conceived and born the miraculous process occurred without vaccines given to the mother. It had been this way since the beginning of mankind. When and why has vaccination begun in pregnant women? What are the threats to health American women posed by diphtheria, tetanus, pertussis, influenza, and COVID-19? Can pregnant women be exposed to the risks of vaccination in order to theoretically pass immunity on to the baby? Scottish Paramedics Told Not to 'Try Too Hard' to Resuscitate Elderly Patients During Pandemic - The Defender - 11th June 2024
Scottish health officials in March 2020 told paramedics they would be fully supported if they did not “try too hard” to resuscitate patients over the age of 70, according to a paramedic’s testimony before the Scottish COVID-19 inquiry. Autism Rates Continue to Climb, Heading Towards 4% Among American Children and Adolescents - Safe Minds - 10th June 2024
Chinese Researchers Find a Significant Decade-Long Increase in ASD Prevalence A recent study from researchers at Guangdong Pharmaceutical University has investigated the prevalence and trends of autism spectrum disorder (ASD) among children and adolescents aged 3–17 years in the United States. The Government Wants us to "Get Back to the Vax" Because the COVID jab lies have put parents off of all vaccines - Substack - Meryl Dorey - 9th June 2024
Childhood vaccination rates down by 20% in Australia. Time to celebrate folks! The government has jumped the shark and there is no putting that particular genie back in the bottle. ds RNA Deep dive - Anandamide - 8th June 2024
The EMA leaks demonstrated lots of consternation from the regulators about the dsRNA levels in the vaccines. We only have EMA leaks for Pfizer so its unclear to what extent this is occurring in Moderna but Moderna’s publication records and patent publications imply it is very much on their radar. Modified mRNA shot lots administered in Australia tested for DNA contamination confirmed to be full of it - Jessica Rose - 7th June 2024
A continuing story of a story that should be front-page news in EVERY media outlet Peer-reviewed confirmation of Tinnitus induced by COVID-19 shots - Jessica Rose - 6th June 2024
The end of gaslighting is in sight... 4 years later There’s a new paper on the loose that supports what many of us have been stating as fact for years: tinnitus is caused by the COVID-19 shots. Long COVID is an Autoimmune Disease: Injecting Mice with IgG from Long COVID Patients Induces Symptomology - WMC Research - 4th June 2024
Revisiting One of My Original Spike Protein Hypotheses in A New Light: The Molecular Mimicry of the Spike Protein Will Induce Autoimmune Disease National Citizens Inquiry - Substack - Anadamide - 1st June 2024
This is the most comprehensive presentation I have given yet on the topic as the NCI allowed for the most time. Even with that time I cannot capture the whole picture and you really need to watch Unacceptable Jessica presentation as she covers the VAERs issues and some other mechanisms for cancer related to Estrogen receptors that Maarten Fornernod has excavated from the literature. Cell invasive amyloid assemblies from SARS-CoV-2 peptides can form multiple polymorphs with varying neurotoxicity - BioRxiv - 16th May 2024
Conclusion Here we further investigated the ability of fragments of SARS-CoV-2 viral proteins to form amyloid assemblies. We show, for the first time, direct evidence of cellular uptake of viral amyloids into neuronal cells, further supporting the hypothesis that some of the neurological symptoms of COVID-19 and PASC may possess a neurotoxic amyloid aetiology. We also observed that in the absence of insoluble amyloid aggregates, known as seeds, in the starting materials these assemblies form less-stable structures which display reduced toxicity, likely due to them being more easily processed and broken down within the cell. Whilst this data is confined to in vitro studies it may offer promise that the neurological effects of COVID-19 and PASC are transient, due to the apparent relative instability of viral amyloids compared to amyloids from neurodegenerative diseases like Alzheimer’s. Further, anti-amyloid therapies may show promise as effective treatments for neuro-COVID and PASC. Israel Didn't Check Most Reports of COVID Vaccine Side Effects: Watchdog - Epoch Health - 29th May 2024
Israeli health officials did not look into hundreds of thousands of reports of problems following COVID-19 vaccination, a watchdog found. Maternal Urinary Fluoride and Child Neurobehaviour at Age 36 Months - Jama Network - 20th May 2024
Findings In this cohort study of 229 pregnant women and their children, a 0.68 mg/L (ie, 1 IQR) increase in specific gravity–adjusted maternal urinary fluoride during pregnancy was associated with nearly double the odds of T scores for total child neurobehavioral problems being in the borderline clinical or clinical range. Breaking Publication -- Excess Cardiopulmonary Arrest and Mortality after COVID-19 Vaccination in King County, Washington - Substack - Peter A. McCullough, MD, MPH
During Intense Vaccine Campaign Population Declined but Cardiac Arrests Skyrocketed. Explosive Report Drops a Bomb on the Entire Childhood Vaccine Schedule! - Rumble - Vigilant News Network - 28th May 2024
It turns out that the shots forced on children to attend school have “negligible or NON-EXISTENT benefits” but “documented side effects.” This is true for many of the most widely-used vaccines, including the MMR, DPT, flu, and the tetanus shots. Determining the risks and benefits of each recommended vaccine. - Substack - A Midwestern Doctor - 26th May 2024
"The blatant dishonesty of our drug regulators throughout COVID-19 has led to many realizing they can’t trust that other recommended vaccines are “safe,” “effective” and “necessary.” Another perspective on the DNA contamination - Anandamide - 25th May 2024
Dr. Arakawa brings up an important point. ssDNA can also create havoc in the cell and shouldn’t we also be quantitating that? We were right! The UK ONS now admit that deaths in the vaccinated were categorised as unvaccinated in 2021 - Substack - Norman Fenton et al - 23rd May 2024
In 2021 when the UK ONS (Office for National statistics) started releasing its vaccine by mortality status reports we exposed that there were large spikes in the non-covid death rates in the 'unvaccinated'. These spikes in mortality coincided with the first main vaccine rollout and did so for each age group. The great FOIA dodge - Substack - Maryanne Demasi, PHD - 23rd May 2024
Freedom of Information Act (FOIA) requests are meant to promote government transparency and accountability, and give the public access to information about the operations and decisions of federal agencies. Recent DNA Contamination paper
Substack - Anandamide - 18th May 2024 It’s a good read with some important points regarding where in the manufacturing procedure these measurements are being made. There are a few points that could use further testing and clarification that do not change the thrust of the paper but perhaps refine the magnitude of the contamination. DNA Contamination in Pfizer COVID Vaccine Exceeded 500 Times Allowable Levels, Study Finds - The Defender 16th May 2024
A new peer-reviewed study raises concerns over inadequate testing methods for measuring DNA impurities in COVID-19 mRNA vaccines. Genomics expert Kevin McKernan critiqued the study’s methods but argued that contamination is still over allowable limits and that current regulations are “entirely unfit for purpose.” Microplastic presence in dog and human testis and its potential association with sperm count and weights of testis and epididymis - Toxicological Sciences - 15th May 2024
"Our study revealed the presence of microplastics in all canine and human testes, with significant inter-individual variability." "These findings highlight the pervasive presence of microplastics in the male reproductive system in both canine and human testes, with potential consequences on male fertility." AstraZeneca vaccine is binned: How the early warnings were ridiculed - TCW - 9th May 2024
WITH the formal withdrawal of the AstraZeneca vaccine announced yesterday, it’s appropriate to remind people of this double-page spread in the Times on March 23, 2021 that hailed the AstraZeneca vaccine as 100 per cent effective. In particular note the article highlighted bottom right. Clot-related adverse events in VAERS 60 days out from last shot - Substack - Jessica Rose - 3rd May 2024
When we wrote up the updated myocarditis paper1, we had an idea to include examples of individuals who had succumbed to myocarditis many months after their last injection of COVID-19 injectable product, as per their reports to VAERS. In both cases included our paper, the product was Pfizer. As you can see in Figure 1 below, a 15-year-old boy had a diagnosis of idiopathic myocarditis that resulted in death 358 days after his first, and last, Pfizer injection. Exclusive: CDC Found Evidence COVID-19 Vaccines Caused Deaths
- Epoch Times - 1st May 2024 U.S. Centers for Disease Control and Prevention (CDC) officials found evidence that the Pfizer-BioNTech and Moderna COVID-19 vaccines caused multiple deaths before claiming that there was no evidence linking the vaccines to any deaths, The Epoch Times has learned,. Safety of Ancestral Monovalent BNT162b2, mRNA-1273, and NVX-CoV2373 COVID-19 Vaccines in US Children Aged 6 Months to 17 Years - Jama - 24th April 2024
Question Were statistical signals detected for health outcomes after ancestral monovalent COVID-19 vaccination in US children aged 6 months to 17 years? Findings In this cohort study of 4 102 106 vaccinated enrollees, 2 outcomes met the statistical threshold for a signal compared with historical rates: myocarditis or pericarditis after BNT162b2 (ages 12-17 years) and seizure after BNT162b2 (ages 2-4 years) and mRNA-1273 (ages 2-5 years) vaccinations. Professor Angus Dalgleish: The mRNA injections are an absolute disaster and should be completely banned - The Expose - 23rd April 2024
In a Hearts of Oak podcast, Professor Angus Dalgleish shared his insights on covid injections, expressing concerns about their impact on cancer patients. He questioned the mRNA technology and emphasised the need for data transparency in the medical field. He also discussed the virus’ origins, indicating the evidence showed the origin was a laboratory, and criticised the government’s handling of the pandemic. Hide the Ball - Substack - Anandamide - 23rd April 2024
More FOIAs have arrived from Health Canada regarding SV40 and DNA contamination. You need to read these to see what ‘Hide the Ball’ looks like. Publicly they have declared these sequences are of no consequence. COVID Spike Proteins Help Cancer Cells Survive, Resist Chemotherapy: Brown University Preprint Paper - Epoch Health - 22nd April 2024
"The preprint authors, led by Dr. Wafik El-Deiry, director of the Cancer Center at Brown University, exposed cancer cells to spike protein subunits. They found that the spike subunits may promote cancer survival and growth by blocking a cancer suppressor gene known as p53.The gene—the most commonly affected by cancer—stops cancer cell growth and encourages DNA repair." A Coup Without Firing a Shot - Brownstonbe Institute - 20th April 2024
The last few years can be tracked at two levels: the physical reality around us and the realm of the intellectual, mental, and psychological. The Government of Canada is Betting $36 Million Taxpayer Dollars That Vaccines Are Not Entirely Safe - Dr. Byram W. Bridle - 19th April 2024
The Canadian Independent does great, grassroots investigative journalism. In this article from yesterday, they pointed this out in the Government of Canada’s 2024 budget…$36 million Canadian taxpayer dollars are being budgeted over the next two years for the Vaccine Injury Support Program that was initiated by the Public Health Agency of Canada alongside the rollout of COVID-19 shots. Review: N1-methyl-pseudouridine: Friend or foe of cancer? - Substack - Jessica Rose - 17th April 2024
Yeah, that would be friend . Of cancer. Not humans. Please refer to the preproof of a new article entitled “Review: N1-methyl-pseudouridine(m1Ψ) : Friend or foe of cancer?” to be served up hot and juicy in the International Journal of Biological Macromolecules soon. The article is pretty long, but the message is simple. The authors found that the N1-methylpseudouridine (m1Ψ) - the same one that induces frameshifting - promotes cancer. Viral afterlife: SARS-CoV-2 as a reservoir of immunomimetic peptides that reassemble into proinflammatory supramolecular complexes - PNAS - 2nd February 2024
We show evidence that viral peptide fragments from SARS-CoV-2 but not harmless coronavirus homologs can “reassemble” with dsRNA into a form of proinflammatory nanocrystalline condensed matter, resulting in cooperative, multivalent immune recognition and grossly amplified inflammatory responses. mRNA is a class one carcinogen - Substack - Professor Ian Brighthope - 17th April 2024
Today, on behalf of my professional friends and medical colleagues, I declare the mRNA vaccines to be class one carcinogens. mRNA is also a broad-spectrum mutagen. mRNA must be banned internationally. Dr. Peter McCullough Sounds the Alarm on COVID Vaccine-Induced "Turbo Cancer" - Vigilant News Network - 16th April 2024
“The COVID vaccines have at least three mechanisms by which they could start a cancer, or they could promote an existing cancer.” College math professor validates my survey conclusions: vaccines ARE the main cause of chronic diseases - Substack - Steve Kirsch - 14th April 2024
Pretty much all mainstream statisticians, data scientists, and epidemiologists ignore my work. But not all. I recently got an email from a college professor of mathematics who decided to do a more detailed analysis to see if my recent survey was accurately reflecting reality. His conclusion: Yes, the survey results are very convincing and we have a very serious problem. The survey results which implicate the vaccines as the primary cause of chronic disease cannot be “explained away” as “biased” or “confounded.” SARS-CoV-2 spike S2 subunit inhibits p53 activation of p21(WAF1), TRAIL Death Receptor DR5 and MDM2 proteins in cancer cells - BioRXiv - 12th April 2024
"We examined the interaction between SARS-CoV-2 spike, p53 and MDM2 (E3 ligase, which mediates p53 degradation) in cancer cells using an immunoprecipitation assay. We observed that SARS-CoV-2 spike protein interrupts p53-MDM2 protein interaction but did not detect SARS-CoV-2 spike bound with p53 protein in the cancer cells. We further observed that SARS-CoV-2 spike suppresses p53 transcriptional activity in cancer cells including after nutlin exposure of wild-type p53-, spike S2-expressing tumor cells and inhibits chemotherapy-induced p53 gene activation of p21(WAF1), TRAIL Death Receptor DR5 and MDM2." Top WHO Official Testifies: Vaccine Passports Were a Scam to Push Fake COVID Shots - Slay News - 12th April 2024
A top official with the World Health Organization (WHO) has admitted during an explosive testimony that the vaccine passports pushed by the agency were just a scam to advance the global vaccination agenda. Did The U.S Death Rate from Measles Decline by over 98% Before Introduction of a Measles Vaccine? - Substack - Aaron Siri - 12th April 2024
Your bite-size dose of immunity against vaccine misinformation. Spread the truth. According to the CDC’s data, the death rate from measles had already declined over 98% between 1900 and 1962, which was before the measles vaccine was introduced in the United States. CDC Study Doesn't 'Debunk' Link Between COVID-19 Vaccines and Sudden Deaths - Epoch Health - 13th April 2024
A new U.S. Centers for Disease Control and Prevention (CDC) study does not disprove a link between COVID-19 vaccines and sudden deaths among young people, contrary to claims. Professor Masayasu Inoue: A Message From Japan To The World - Rumble - Sunfellow On COVID-19 - 11th April 2024
A Message From Japan To The World Delivered by Prof Masayasu Inoue, Professor Emeritus of Osaka City University Medical School Peer-Reviewed Study Drops Bombshell on Pfizer's Paxlovid - VNN - 8th April 2024
A new study published in the New England Journal of Medicine (NEJM) raises serious questions about the efficacy of Pfizer’s antiviral drug Paxlovid, which was previously authorized for emergency use to treat mild to moderate COVID-19 cases. Scientist's Video on Vaccination Status in Pregnancy Censored for 'Misinformation' - Epoch Health - 8th April 2024
A mathematician has had a YouTube video taken down after pointing out that the government is counting women who had the COVID-19 vaccines before conceiving as “unvaccinated,” effectively obscuring any potential link between the jabs and negative pregnancy outcomes. A Substack on Sanger, Next Generation and Oxford Nanopore sequencing techniques - Substack - Jessica Rose - 7th April 2024
For anyone reading or simply following Kevin McKernan’s vital work on the subject matter of ‘what’s in the COVID modified mRNA product vials’, you will have come across various sequencing techniques and names like Illumuna (Next Generation Sequencing), Sanger and Oxford Nanopore. I decided it’s important for you all who don’t have a background in genomics (like me!) to know a little bit more about what these sequencing methods involve, why they are different and how they are different. I think this is really important because of what’s coming in the future and the best weapon against totalitarianism is knowledge. Double-Edged Syringe: Jenner, WHO & the Vaccine March to Gobal Dominance - Christof Plothe, DO - Bright Light News - 2nd April 2024
“Before the advent of most of the vaccines in the 1960s, the morbidity and mortality of most diseases had come down significantly due to clean water, refrigeration, better hygiene,” emphasized Christof Plothe, DO, World Council for Health (WCH), during our discussion in Geneva at the WHO headquarters. What Makes All Vaccines So Dangerous? - Substack - A Midwestern Doctor - 31st March 2024
Since vaccines frequently cause a wide range of side effects this makes it challenging to identify what the common thread between those injuries. One of the best candidates that has been put forward is vaccination triggering microstrokes throughout the body—a process which I believe also underlies many other chronic diseases. Giving children covid vaccines is unethical and reckless - our letter to pharmacy chiefs - The Conservative Women - 29th March 2024
I am writing to draw your attention urgently to the major breach of ethical principles if your companies proceed to offer Covid-19 vaccinations privately to healthy children aged 12 years and above at a time when the NHS has effectively withdrawn the vaccines for all healthy under-75s. DNA found integrated in cancer cell line - Jessica Rose - 27th March 2024
"Any foreign DNA that might have found its way into the cell could get packaged into the nucleus when the nuclear membranes reform. It could also get into the nucleus via transport by nuclear location sequences like SV40." Persistence of S1 Spike Protein in CD16+ Monocytes up to 245 Days in SARS-CoV-2 Negative Post COVID-19 Vaccination Individuals with Post-Acute Sequalae of COVID-19 (PASC)-Like Symptoms - MedRXiv - 24th March 2024
"There have been concerning reports about people experiencing new onset persistent complications (greater than 30 days) following approved SARS-CoV-2 vaccines (BNT162b2 (Pfizer), mRNA-1273 (Moderna), Janssen (Johnson and Johnson), and ChAdOx1 nCoV-19 (AstraZeneca)). We sought to determine the immunologic abnormalities in these patients and to investigate whether the potential etiology was similar to Post-Acute Sequalae of COVID (PASC), or long COVID." Young Children Died at Higher Rates in 2021-2022, as Adult Life Expectancy Rebounded - The Defender - 26th March 2024
Death rates among children ages 1-4 jumped 12% between 2021 and 2022, and for kids 5-14 the rate increased by 7% over the same period, according to data released this month by the CDC. Vaccinated People Are Immune Imprinted, Has Unusual Response to COVID-19 mRNA Boosters - Epoch Health - 24th March 2024
People who have taken at least three doses of the original version of the COVID-19 mRNA vaccine have been strongly immune imprinted, a study by the University of Washington (UW) found. Consequently, when vaccinated with the most recent COVID-19 XBB.1.5 mRNA boosters, recipients produced few to no antibodies specific to the XBB.1.5 variant. The Century of Evidence That Vaccines Cause Sudden Infant Deaths - A Midwestern Doctor - 21st March 2024
The Disturbing Parallels between Sudden Infant Death Syndrome and Sudden Adult Death Syndrome DNA May Be Altered by COVID Infection or Vaccine, Potentially Leading to Cancer - Epoch Health - 22nd March 2024
Since the COVID-19 pandemic, we’ve seen an increase in mortality from cancer in the United States, England, and Wales. China has also reported clusters of blood cancer cases.Multiple factors lie behind this trend in cancer, and DNA impairment appears to be one of them. Human Gene Therapy Products Incorporating Human Genome Editing - Jessica Rose -17th March 2024
As of January 2024, the Human Gene Therapy Products Incorporating Human Genome Editing: Guidance for Industry can be found here. The HHS, FDA and CBER decided they needed to update guidance for industry on the subject matter of human gene therapy products incorporating human genome editing. I can’t imagine why. Concerns regarding Transfusions of Blood Products Derived from Genetic Vaccine Recipients and Proposals for Specific Measures - Preprints.org - 15th March 2024
In this article, based on these circumstances and the volume of evidence that has recently come to light, we call the attention of medical professionals to the various risks associated with blood transfusions using blood products derived from people who have suffered from long COVID and from genetic vaccine recipients, including those who have received mRNA vaccines, and we make proposals regarding specific tests, testing methods, and regulations to deal with these risks. We expect that this proposal will serve as a basis for discussion on how to address post-vaccination syndrome and its consequences following these genetic vaccination programs. Pharmaceutical Company Discloses Why It Stopped Trials of New Vaccine - Epoch Health - 14th March 2024
The pharmaceutical giant GlaxoSmithKline (GSK) abandoned a maternal vaccine because there was an unexplained higher incidence of preterm birth among infants whose mothers received the shot, the company disclosed in a new study. Secret Recording Catches Pfizer Scientist Saying the Quiet Part Out Loud - VNN - 13th March 2024
Justin Leslie, a former operative with Project Veritas and O’Keefe Media Group, and a scientist previously involved in vaccine formulation at Pfizer, has brought to light unreleased recordings that raise serious questions about the pharmaceutical giant’s development and promotion of its COVID-19 vaccines. The Ugly History of Vaccines: Part 1 - Dr. Suzanne Humphries - EpochTV - 9th March 2024
In 2008, Dr. Suzanne Humphries noticed that her patients were being vaccinated in the hospital she worked at with a signature bearing her name. She did not consent to this, but it was part of a new hospital policy at the time. This incident pushed her to look into vaccination. How Measles Vaccines Alter Our Natural Immunity - Epoch Health - 9th March 2024For many years, we’ve been told that the measles vaccine is responsible for stopping the spread of measles. Many even blame the occurrence of measles cases on low vaccination rates.
Accelerated brain age in young to early middle-aged adults after mild to moderate COVID-19 infection - MedRxiv - 5th March 2024
Additionally, 80% of the COVID-19 group demonstrated an accelerated BAG compared to 13% in the control group (X2 = 20.0, p < 0.001). Accelerated BAG was significantly correlated with lower cognitive function (p < 0.041). Why we kill our own cells? - HART - 7th March 2024
A virus hijacks a cell to replicate itself. There is more than one way in which our immune systems can defend us from them. Our bodies have developed sophisticated defence mechanisms to protect us. This article explores how our immune system combats viral infections and the unique challenges presented by cells containing mRNA from vaccines. The Path of Heterodoxy - Substack - Alex Washburne - 2nd March 2024
I shall be telling this with a sigh Somewhere ages and ages hence: Two roads diverged in a wood, and I-- I took the one less traveled by, And that has made all the difference. -Robert Frost Homeopathic Lifestyle Ruled a 'Protected Characteristic' in Tribunal Ruling for Fired NHS Worker - Workers of England Union - 7th February 2024
A tribunal judge has ruled that belief in a homeopathic lifestyle and bodily autonomy is a “protected characteristic” under the Equality Act in an unfair dismissal case for a former ambulance operations manager who lost his job for declining the COVID-19 vaccines. Higher Mortality Found Among Vaccinated Patients Hospitalized for COVID-19: New Study - Epoch Health - 1st March 2024
Among hospitalized patients with COVID-19, a new study found that vaccinated patients had a significantly higher risk of mortality, suggesting vaccination may not prevent severe outcomes among hospitalized patients. Del Bigtree - Federal Health Agencies & The COVID Cartel: What Are They Hiding? - Rumble - Sunfellow On COVID-19 - 28th February 2024
Del Bigtree, CEO of the Informed Consent Action Network (ICAN) and host of The Highwire, speaking at the COVID-19 roundtable meeting hosted by U.S. Senator Ron Johnson on Monday, February 26, 2024. Prevalent and persistent new-onset autoantibodies in mild to severe COVID-19 - MedRxiv - 15th February 2024
"While all 456 HCW that were assessed for new-onset autoantibodies had seroconverted before vaccination, 362 (79%) received their first SARS-CoV-2 vaccine dose during the study period. The majority received the Pfizer/BioNTech vaccine (68%, n=248), 30% received the AstraZeneca vaccine (n=107), and 2% received the Moderna vaccine (n=7). With this in mind, we asked whether any of the 22 most prevalent autoantibodies increase after vaccination. Considering changes at the level of log2 FC ≥ 2, we identified 12 autoantibodies in 45 individuals (Fig. S6). Notably, anti-SNURF IgG was the most commonly increasing autoantibody after vaccination (67%; detected in 30 of 45 HCW displaying an increase). Exclusive: Health Canada Official Deleted Scientist's Note Saying MRNA Shots Have 'High Level of Impurity': Internal Emails - Epoch Health - 24th February 2024
A senior Health Canada official removed mention of a “high level of impurity” in mRNA COVID-19 vaccines in an assessment done by a colleague for the department’s chief medical adviser, internal records show. The assessment was meant as a brief on recent findings about the creation of unintended proteins by mRNA COVID-19 vaccines. A Host of Notable COVID-19 Vaccine Adverse Events, Backed by Evidence - Epoch Health - 23rd February 2024
Since the rollout of COVID-19 vaccines, a significant number of vaccinated people have reported various adverse reactions. Some adverse events are widely acknowledged, like blood clots and myocarditis. Others are less publicly discussed but are still present in the research literature. Episode 360: The Clot Thickens - The Highwire - 22nd February 2024
The V-safe Free-Text Data is Out and Aaron Siri, esq., Has the Details; Jefferey Jaxen reports on the state of vaccine mandates and informed consent in a post-COVID world, and a new vaccine technology beyond injectables that takes it a step too far; The Clot Thickens As A New Study The Severity of The Blood Clot Problem; Funeral director and embalmer’s firsthand account corroborates Haviland’s survey data. Guests: Aaron Siri, Esq., Thomas Haviland, Richard Hirschman Paralyzed from the Neck Down After Third Modified RNA Shot - Substack - Dr. Byram W. Bridle - 18th February 2024
"I just finished reading a news story and watching the associated video interview. It is remarkable and something that everyone should be aware of because it is so tragic, yet so typical of what is happening these days." Cases of Debilitating POTS Condition Rise After COVID-19; New Research Points to Possible Treatment - Epoch Health - 15th February 2024
For the estimated 1 million to 3 million Americans living with postural orthostatic tachycardia syndrome (POTS), standing up can trigger a racing heartbeat, lightheadedness, and fainting that’s relieved only by sitting or lying down. However, a new clinical trial offers a glimmer of hope for those desperate for relief. Researchers may have uncovered a novel, nonpharmaceutical way to manage this debilitating syndrome on the rise nationwide. WHO Projects 77 Percent Rise in Cancer; Unvaxxed Tracked by New CDC Medical Codes - Facts Matter - EpochTV - 15th February 2024
About a week ago, the World Health Organization released a shocking projection. Specifically, the International Agency for Research on Cancer (which is a sub-agency of the WHO) they released a report which projected a 77 percent increase in the number of cancer cases (worldwide) by the year 2050: Viroids and Obleisks - Anadamide - 4th February 2024A new biological entity was discovered this week known as an Obelisk.
This is a very important missing link between Viroids and Viruses. Followers of this stack know that we spend a lot of time studying Hop Latent Viroid that infects the cannabis plant. This is an excellent example that melts the minds of the ‘no-virus’ and ‘PCR is useless’ camp. Transplacental Transmission of the COVID-19 Vaccine mRNA: Evidence from Placental, Maternal and Cord Blood Analyses Post-Vaccination - Ajog- 24th January 2024
Conclusions Our findings suggest that the vaccine mRNA is not localized to the injection site and can spread systemically to the placenta and umbilical cord blood. The detection of the spike protein in the placental tissue indicates the bioactivity of the vaccine mRNA reaching the placenta. Notably, the vaccine mRNA was largely fragmented in the cord blood and, to a lesser extent, in the placenta. To our knowledge, these two cases demonstrate, for the first time, the ability of the COVID-19 vaccine mRNA to penetrate the fetal-placental barrier and reach the intrauterine environment. COVID: All Australian governments failed completely - Substack - Ian Brighthope - 4th February 2024
Long form Submission from Ian Brighthope in gratitude to Senator Malcolm Roberts and his Senatorial colleagues seeking the truth about the Covid Plandemic. SARS-CoV-2 associated T-cell infiltration in the central nervous system - Wiley - 31st January 2024
"Another aspect that needs to be considered in the future is the potential cross-reactivity of virus-specific T-cell activation. In autoimmune diseases, such as multiple sclerosis, a transient increase of Epstein–Barr virus (EBV) antibody titres was associated with a higher risk for a disease onset, indicating that misguided T-cell reactivity could be initiated as a result of temporary viral infections. This concept was initially described as ‘molecular mimicry’. Our detection of SARS-CoV-2-associated T-cell clonotypes in the brain of severely infected patients therefore points to either ongoing SARS-CoV-2 antigen presentation, persistent infiltration of formerly activated virus-specific T cells or, in rare circumstances, the recognition of a potential molecular mimicry antigen." Local Authority Takes Mother to Court for Refusing to Vaccinate Severely Disabled Son - 30th January 2024
A legal battle will return to the high court after two judges ruled a 23-year-old mentally disabled man should be given the COVID-19 vaccines in spite of his mother’s wishes and a specialist report warning the jab could cause him serious harm. Flawed studies desperately attempting to prop up the 'official' covid narrative are getting worse - Substack - Norman Fenton and Martin Neil - 24th January 2024
No matter how many times we (and others) have pointed out the statistical flaws and biases that compromise covid studies (especially those attempting to show vaccine effectiveness and safety), studies continue to be published in the most prestigious medical journals that should never have passed review because of these flaws. COVID-19 mRNA [Injections]: Lessons Learned from the Registrational Trials and Global [Injection] Campaign - Jessica Rose - 25th January 2024
"Re-analysis of the Pfizer trial data identified statistically significant increases in serious adverse events (SAEs) in the vaccine group. Numerous SAEs were identified following the Emergency Use Authorization (EUA), including death, cancer, cardiac events, and various autoimmune, hematological, reproductive, and neurological disorders. Furthermore, these products never underwent adequate safety and toxicological testing in accordance with previously established scientific standards". Open letter to national newspaper re: compulsory vaccines - Substack - iInformed consent matters - 24th January 2024
I read your article dated 22nd January, 2024, despite my initial deep reservations regarding the headline. I hoped this sensationalist title was merely 'clickbait' to entice people to open it (I know The Independent struggles with low readership), rather than serving as an accurate reflection of the article's content. Precision microbial intervention improves social behaviour but not autism severity: A pilot double-blind randomized placebo-controlled trial - Cell Host & Microbe - 18th December 2023
L. reuteri (6475 + 17938) improves social functioning in children with autism L. reuteri does not improve overall autism severity or repetitive behaviors L. reuteri does not significantly alter microbiome composition or immune profile Only the 6475 strain reverses the social deficits in a mouse model for autism Exclusive: 70% of Embalmers Reported Finding Strange Blood Clots Beginning Mid - 2021 - The Defender - 22nd January 2024
In a recent survey of 269 embalmers across four major countries and three continents, more than 70% reported finding strange fibrous white blood clots in significant percentages of corpses in 2023 — clots they were not finding pre-pandemic. mRNA Technology Is the Culprit Behind Faulty Immune Response That Prolonged the Pandemic, IgG4 Study Shows - Subatack - Igor Chudov - 21st January 2024
"Scientists discovered that, despite all groups of patients receiving three injections, the IgG4 class switch happened only in the mRNA group". US scientists proposed to make viruses with unique features of SARS-CoV-2 in Wuhan - U.S/. Right To Know - 18th January 2024
American scientists planned to work with the Wuhan Institute of Virology to engineer novel coronaviruses with the features of SARS-CoV-2 the year before the virus emerged from that city, according to documents obtained by U.S. Right to Know. Safety of Monovalent BNT162b2 (Pfizer-BioNTech), mRNA-1273 (Moderna), and NVX-CoV2373 (Novavax) COVID-19 Vaccines in US Children Aged 6 months to 17 years - MedRxiv - 15th January 2024
Conclusions and Relevance Of the two signaled outcomes, the myocarditis or pericarditis signals are consistent with previously published reports. The new signal detected for seizures/convulsions among younger children should be further investigated in a robust epidemiological study with better confounding adjustment. Long COVID manifests with T cell dysregulation, inflammation and an uncoordinated adaptive immune response to SARS-CoV-2 - Nature Immunology - 11th January 2024
"LC individuals displayed increased frequencies of CD4+ T cells poised to migrate to inflamed tissues and exhausted SARS-CoV-2-specific CD8+ T cells, higher levels of SARS-CoV-2 antibodies and a mis-coordination between their SARS-CoV-2-specific T and B cell responses. Our analysis suggested an improper crosstalk between the cellular and humoral adaptive immunity in LC, which can lead to immune dysregulation, inflammation and clinical symptoms associated with this debilitating condition." COVID Vaccines Cause Autism in Lab Rats, Study Finds - Substack - Igor Chudov - 12th January 2024
A friend of this blog, Ashmedai, highlighted a fascinating animal study, which found that giving pregnant rats the Pfizer COVID vaccine induced ‘autism-like’ traits in the male pups born after such vaccination. RSV reports in VAERS (AREXVY and ABRYSVO) - Substack - Jessica Rose - 12th January 2024
Now that these products have been deployed, we are already seeing reports of AEs and SAEs being reported to VAERS. 68% of the reports have been filed in the context of the Arexvy product. To date, there are 2,903 VAERS IDs reported with a 13% SAE reporting rate whereby 38% of the reports were filed on the same day as the vaccine was administered. Protect Babies from the Injection of Beyfortus (RSV monoclonal) - Substack - Sasha Latypova - 6th January 2024
Helene Banoun is a pharmacist-biologist, former INSERM researcher, based in France. She writes in an email: "Since December 6, when I alerted the public about the French government's uncontrolled clinical trial, Twitter France has made me invisible. In France, the injection of Beyfortus (nirsevimab, a monoclonal antibody against bronchiolitis caused by RSV) is recommended for all newborns from the maternity ward. This treatment has not been tested on newborns, but on children aged between 3 months and 2 years! " How Many "Conspiracy Theories" Need to Be Proven True Before the Term Is Abandoned? - Vigilant News - 8th January 2024
How many so-called “conspiracy theories” need to be proven true before the term is finally abandoned? The term was first used by the CIA to shut down those who doubted the official line about the murder of JFK. Here are some “conspiracy theories” that turned out to be true: mRNA Covid Vaccines Worsen Diabetes, Study Finds - Igor Chudov - 6th January 2024
A new study by Zhai et al. found disturbing effects of mRNA COVID vaccines on people who are diabetic or prediabetic. Authors report that “61.1% of patients with type 2 diabetes, but not healthy controls, exhibited aggravated insulin resistance towards the booster shots of the COVID-19 vaccine”. Bret Weinstein Exposes the World Health Organization's Dark Agenda - Tucker Carlson - Rumble - 6th January 2024
Tucker Carlson and Bret Weinstein discuss Big Pharma and the World Health Organization's dark agenda. Sharyl Attkisson's Exceptional interview with Dr. Zimmerman, with clear evidence that vaccines, childhood vaccines, in a subset of children & vaccine induced fever etc. can cause brain damage, autism - Substack - Dr. Paul Alexander - 5th January 2024
"a spectrum of illness; it's becoming clearer that governments in US, Canada etc. have covered up role of childhood vaccines in causing autism, an autism spectrum; features of autism spectrum disorder" Aluminium Adjuvants Used in Some COVID Vaccines May Increase Risk of Serious Respiratory Disease - The Defender - 3rd January 2024
A COVID-19 vaccine ingredient may improve the product’s effectiveness against a single targeted virus strain but could raise the risk of serious respiratory illness after exposure to new virus strains, according to a preprint study. A Global News Investigation Misses the Mark - Substack - Dr. Byram W. Bridle - 3rd January 2024
"Global News is part of Canada’s legacy media and they apparently spent a full year ‘investigating’ the fact that my government spent two billion Canadian tax dollars to purchase 400 million rapid antigen test kits for COVID-19 from a Canadian supplier called BTNX, which imported the kits from China. Their key issue is whether BTNX may have overstated the sensitivity of their test." SARS-CoV-2 Infection and Potentially COVID-19 Vaccination Associated With False Positive HIV Tests - Epoch Health - 31st December 2023
“Our team became aware of the possibility of false positive HIV tests (all but HIV PCR) in individuals vaccinated against Sars-CoV-2 when a laboratory technician attempted suicide. The reason: five months after his second vaccination against Sars-CoV-2 (being negative for Sars-CoV-2 nucleocapsid antibodies at all times) his HIV antibody tests as well as the usual confirmatory HIV tests yielded positive results." Experts Claim 'Heart Failure Pandemic' On Its Way - Substack - The Naked Emperor - 28th December 2023
"The report published in Cell warns that people with long-term heart conditions (chronic cardiomyopathy) might be particularly vulnerable to Covid. This is because the virus targets a specific receptor (ACE2) which is found abundantly in human hearts. The authors fear that Covid could lead to a large number of heart failure cases worldwide because the virus can persist in the heart." Para-infectious brain injury in COVID-19 persists at follow-up despite attenuated cytokine and autoantibody responses - Nature Communications - 22nd December 2023
"Autoantibodies are more common in COVID-19 than controls and some (including against MYL7, UCH-L1, and GRIN3B) are more frequent with altered consciousness. Additionally, convalescent participants with neurological complications show elevated GFAP and NfL, unrelated to attenuated systemic inflammatory mediators and to autoantibody responses. Overall, neurological complications of COVID-19 are associated with evidence of neuroglial injury in both acute and late disease and these correlate with dysregulated innate and adaptive immune responses acutely." SARS-CoV-2 Vaccination and the Multi-Hit Hypothesis of Oncogenesis - Cureus - 17th December 2023
"This hypothesis is based on biological plausibility and fulfillment of the multi-hit hypothesis of oncogenesis (i.e., induction of lymphopenia and inflammation, downregulation of angiotensin-converting enzyme 2 (ACE2) expression, activation of oncogenic cascades, sequestration of tumor suppressor proteins, dysregulation of the RNA-G quadruplex-protein binding system, alteration of type I interferon responses, unsilencing of retrotransposable elements, etc.) together with growing evidence and safety reports filed to Vaccine Adverse Effects Report System (VAERS) suggesting that some cancer patients experienced disease exacerbation or recurrence following COVID-19 vaccination. In light of the above and because some of these concerns (i.e., alteration of oncogenic pathways, promotion of inflammatory cascades, and dysregulation of the renin-angiotensin system) also apply to cancer patients infected with SARS-CoV-2, we encourage the scientific and medical community to urgently evaluate the impact of both COVID-19 and COVID-19 vaccination on cancer biology and tumor registries, adjusting public health recommendations accordingly." DR. Douglas Hulstedt: 40% - 50% of autism cases are caused by childhood vaccines - The Expose - 27th December 2023
Although Dr. Douglas Hulstedt himself is without a doubt that vaccines caused 40%-50% of the autism cases he saw in his practice, he told Steve Kirsch during an interview that vaccines cause up to 90% of the autism cases according to a doctor practising family medicine in Louisiana who has treated over 8,000 cases. A Primer on Medical Gaslighting - A Midwestern Doctor - 22nd December 2023
In a recent series, I discussed the unsafe and ineffective the SSRI antidepressants are and how the immense amount of money made from selling depression (and its indefinite “treatment”) to everyone caused effective cures for depression to become almost completely forgotten. Author of Study Used to Vilify Unvaxed Had Ties to Pfizer - New Peer-Reviewed Research Shows Why the Study Was Flawed - The Defender - 22nd December 2023
A new peer-reviewed study by researchers Joseph Hickey, Ph.D., and Denis Rancourt, Ph.D., re-examined the mathematical models used to justify policies that barred unvaccinated people from public venues. They found the models were based on the application of flawed mathematical risk models. There's no problem here. Look away. - Jessica Rose - 17th December 2023
Here is the response from Peter Marks, MD, PhD to Joseph A. Lapado, MD, PhD. Peter Marks is the Director of the Center for Biologics Evaluation and Research and Joseph A. Lapado is the surgeon general of Florida. VAERS reports contradict claim of no AEs in frameshifting context - Substack - Jessica Rose - 16th December 2023
"Where is the evidence to support the claim that there are no adverse event outcomes in this context? According to a query of the MedDRA code “Autoimmune disorder” in the Vaccine Adverse Events Reporting System (VAERS), there is an 803% increase in reporting rate per million doses administered when comparing Influenza vaccines administered from 2018 through 2020 to COVID-19 modified mRNA injections administered from 2021 through 2023. It is worth noting that the reports exclude individuals with a history of an autoimmune disorder." "Self-assembling amyloid-like nanostructures from SARS-CoV-2 S1, S2, RBD and N recombinant proteins - ScienceDirect - 9th December 2023
"Self-assembling nanoparticles (saNP) and nanofibers were found in the recombinant coronavirus SARS-CoV-2 S1, S2, RBD and N proteins purified by affinity chromatography using Ni Sepharose." "Taken together, spontaneous formation of the amyloid-like self-assembling nanostructures due to the internal affinity of the SARS-CoV-2 virion proteins might induce proteinopathy in patients, including conformational neurodegenerative diseases, change stability of vaccines and diagnostic systems." Demyelination in Patients with Post-COVID Depression - Preprints.org - 10th December 2023
This study, for the first time, reveals extensive demyelination in numerous WM and GM structures in PCD, outlining IFOF demyelination as a key biomarker. mRNA RSV Vaccine: 81 Adverse Reactions per Each Prevented Case of RSV - Igor Chudov - 15th December 2023
"All of this misery and suffering, like 70 vaccine-caused long-term underarm lymph node swellings and 1,620 vaccine-caused total lymph node swellings, was imposed upon the unlucky vaccinated subgroup to prevent a measly 66 cases of RSV. " An explosive new study describing "unintended immune responses" from mRNA injections has dropped a tactical nuke on Pfizer - The Expose - 10th December 2023
Last Wednesday, The Telegraph published an article on a study that showed one in four who had Moderna or Pfizer Covid jabs experienced an unintended immune response. This “unintended immune response,” The Telegraph reported, was created by a “glitch” in the way the vaccine was read by the body. Ribosomal frameshifting and misreading of mRNA in COVID-19 vaccines produces "off-target" proteins and immune responses eliciting safety concerns: Comment on UK study by Mulroney et al - ResearchGate - December 2023
"The finding that unintended proteins may be produced as a result of vaccination is sufficient cause for regulators to conduct full risk assessments of past or future harms that may have ensued. Given that this study was conducted under the auspices of the United Kingdom Government, we must assume UK regulators, manufacturers, and international regulatory agencies, including FDA, were apprised of the data many months ago. We await their account of what steps they have taken to investigate why the formation of off-target proteins was not discovered sooner, what toxic effects they may have caused and what steps they are taken to prevent harm in the future and to inform the public of these findings." "The paper was received by Nature on January 25, 2023, accepted for publication on October 31, 2023 and published today, December 6, 2023. This time frame appears rather protracted given the significance of these findings. The study was funded and conducted by agencies of the United Kingdom. The evidence for the formation of off-target proteins must surely be considered a reportable adverse event." N1- methylpseudouridylation of mRNA causes +1ribosomal frameshifting - Nature - 6th December 2023
"Here we demonstrate that incorporation of N1-methylpseudouridine into mRNA results in +1 ribosomal frameshifting in vitro and that cellular immunity in mice and humans to +1 frameshifted products from BNT162b2 vaccine mRNA translation occurs after vaccination. The +1 ribosome frameshifting observed is probably a consequence of N1-methylpseudouridine-induced ribosome stalling during IVT mRNA translation, with frameshifting occurring at ribosome slippery sequences." "It is important to continue investigating therapeutic mRNA mistranslation and immunogenicity, as the evolution of antibody and cytolytic T cell responses against +1 frameshifted spike variants and peptides has not been systematically evaluated in humans and ELISpot responses obtained from pooled peptides may also underestimate T cell responses.The main in-frame mRNA-encoded product is unlikely to elicit an adaptive immune response, but presentation of +1 frameshifted products could activate T cells that target host cells. " "We show that 1-methylΨ is a modified ribonucleotide that significantly increases +1 ribosomal frameshifting during mRNA translation and that cellular immunity to +1 frameshifted products can occur following vaccination with mRNA containing 1-methylΨ. To our knowledge, this is the first report that mRNA modification affects ribosomal frameshifting. Alongside this impact on host T cell immunity, the off-target effects of ribosomal frameshifting could include increased production of new B cell antigens." Testimony in UK Parliament: Show us the data! -Substack - Robert W Malone MD, MS - 5th December 2023
The expert testimony at the invitation of MP Andrew Bridgen in the UK parliament yesterday was important. The room was overflowing with people. Many members of Parliament and Lords showed up to listen. The testimony given by myself as well as other scientists and physicians was science based, truthful and accurate. Pilots and the vaccines - your questions answered - The Conservative Women - 4th December 2023
WE HAD a tremendous response to our report last month, 'Pilot warns of airline industry disaster due to Covid vaccines'. It looked at the huge increase in mayday distress calls by pilots over the last two years. Natural immunity lasts for at least 100 years & I (Oskoui, McCullough, Risch, Tenenbaum, Ladapo et al.) told you this. - Substack - Dr. Paul Alexander - 25th November 2023
The research told us that survivors of the 1918 influenza pandemic (as kids then) possess highly functional, virus-neutralizing antibodies to this uniquely virulent virus, and that humans can sustain circulating B memory cells to viruses for many decades after exposure—well into the tenth decade of life. Genetically Modified Organons - Substack - Arkmedic - 29th October 2023
This week could well have been a defining moment in the unravelling of the burning pyre of lies that we have been plagued with for the last 4 years (actually much longer but that might be a story for another day). And it belongs to Senator Gerard Rennick, who has been an absolute stalwart in the fight for truth over that time. Data from the New Zealand Ministry of Health shows that the COVID vaccines have killed over 10 million worldwide - Substack - Steve Kirsch - 30th November 2023
It's finally here: record-level data showing vaccine timing and death date. There is no confusion any longer: the vaccines are unsafe and have killed, on average, around 1 person per 1,000 doses. Excess Deaths among Children continue to rise in the Thousands across Europe following EMAs Emergency Use Authorisation of the Covid-19 Vaccine for Kids - The Expose - 22nd November 2023
Excess deaths among children across Europe were negative compared to the previous average throughout 2020 and 2021 until the European Medicines Agency (EMA) extended the Emergency Use Authorisation (EUA) of the COVID-19 vaccine to Children. Curiously, from this point onwards, excess deaths among children across Europe began to rise significantly up to the end of 2021 and have continued to do so throughout 2022 and 2023. Calls to 'Stop the Shots' Intensify - The Defender - 15th November 2023
A growing number of groups worldwide, led by doctors, medical organizations and activists are demanding an end to COVID-19 vaccine campaigns, citing contamination, injuries and lack of informed consent. The mRNAs didn't end Covid, Omicron did - Substack - Alex Berenson - 20th November 2023
Sometimes the answer just needs to be color-coded. For years, mRNA advocates have tried to give the jabs credit for ending the pandemic, despite massive evidence they stopped working within months and the observational data showing lower deaths among the vaccinated is hopelessly biased. New Report: Young People Dying of Cancer at 'Explosive' Rates, UK Government Data Show - The Defender - 21st November 2023
An analysis of U.K. government data shows an unprecedented increase in cancer deaths among 15- to 44-year-olds following the rollout of COVID-19 vaccines, according to a new report by data analyst Edward Dowd. The report has prompted renewed calls for further investigation. Patent tour and freezer clean out - Substack - Anandamide - 18th November 2023
To bring some context to the dsDNA contamination its important to see a few patents that have the CEO of Moderna as an inventor. The U.S. Army is 'Begging' Unvaccinated Soldiers to Return - Substack - Igor Chudov - 17th November 2023
Oh, how much the times have changed! The United States Army is now begging COVID unvaccinated soldiers, who underwent involuntary discharge for their refusal to take the vaccine, to return to service and also permits them to correct their military records! miR142-3p binding site variant 3 - Substack - Anandamide - 16th November 2023
What is this doing in the Moderna vaccine? "But Moderna also has an interesting sequence in its 3’UTR. This is not a contaminant but included in every mRNA molecule injected (well, most mRNAs as they have lots of truncated mRNA that is likely missing the 3’ end). If you simply Google this sequence ‘TGATAATAGGCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTC’ You will find 4 Moderna patents that predate C19. Polynucleotides encoding coagulation factor VIII. Vitamin B12: a key player in celluar reprogramming and tissue regeneration - Scientific - 16th November 2023
Researchers at IRB Barcelona reveal that vitamin B12 significantly boosts the efficiency of cellular reprogramming, thus holding promise for regenerative medicine. Vitamin B12 supplementation shows potential in speeding up tissue repair in a model of ulcerative colitis—an observation that points to potential new treatments for inflammatory diseases. Deaths of Scottish babies - HART - 16th November 2023
Public Health Scotland demonstrated a significant increase in neonatal deaths (in the first month of life) in 2021 but refused to investigate whether it was related to the vaccine because such an analysis “whilst being uninformative for public health decision making, had the potential to be used to harm vaccine confidence”. We Need More Heroes Like Dr Mark Trozzi - Principia Scientific - Dr. Tess Lawrie, MBBCh, PhD - 16th November 2023
My dear WCH colleague Dr Mark Trozzi has been found “guilty” of trying to save humanity by the corrupt College of Physicians and Surgeons of Ontario Schrodinger's SV40 and p53 - Substack - Anandamide - 14th November 2023
It only exists if you know how to look.On sunday, Wafik El-Deiry and Phillip Buckhaults were accused of feeding anti-vax platforms by pointing out some little known details about SV40 Promoters. The prevalence of post-COVID-19 vaccination syndrome and quality of life among COVID-19 vaccinated individuals - ScienceDirect -10th November 2023
Conclusion In the study, we observed the prevalence of PCVS and was similar to long-term COVID; it declined over time and increased following booster immunization. Contrary to PCVS prevalence, QoL rises with time and falls after booster doses. There is no difference in the prevalence of PCVS and the quality of life among AZD1222® and BBV152®. Post-Vaccination Syndrome: A Descriptive Analysis of Reported Symptoms and Patient Experiences After Covid-19 Immunisation - MedRxiv - 10th November 2023
Conclusions: In this study, individuals who reported PVS after covid-19 vaccination had low health status, high symptom burden, and high psychosocial stress despite trying many treatments. There is a need for continued investigation to understand and treat this condition. AstraZeneca Taken to Court Over "Defective"Covid jab in Landmark Legal Case - The Daily Sceptic - 8th November 2023
The Oxford-AstraZeneca COVID-19 vaccine has been branded “defective” in a multi-million pound landmark legal action that will suggest claims over its efficacy were “vastly overstated”. The Telegraph has the story. Could willow bark provide out next life-saving antiviral medicine - EurekAlert - 8th November 2023
Willow bark has already given us aspirin — now it might be the source of a crucial new antiviral medicine. Scientists in Finland have now shown that an extract of willow bark — a plant which has already provided several medicines, including the precursor to modern aspirin — has a broad-spectrum antiviral effect in cell sample experiments. Viruses Reactivated After COVID-19 and Its Vaccine May Be Linked to Lymphopenia: Study - Epoch Health - 7th November 2023
Persistent lymphopenia is a hallmark of immune deficiency, which can put people at risk of opportunistic infections including reactivated viruses. SARS-COV-2 Induced Amyloidgenesis: Not One, but Three Hypotheses for Cerebral COVID-19 Outcomes - PMC - 12th November 2022
"Herein, we will address three hypotheses of biochemical alterations that involve the triggering and/or worsening of the formation of amyloid-like protein aggregates (amyloidosis) by SARS-CoV-2 infection and could explain, in part, the more severe and/or lasting neuropsychiatric manifestations of COVID-19." ABC Blames "Republicans" for Infant Mortality Increases Following COVID Vaccinations Of Pregnant Moms and Babies - Substack Igor Chudov - 2nd November 2023
The CDC just reported significant increases in infant mortality that started in 2022 and continued in 2023. I put an annotated screenshot of the above page so you can see how increases in infant mortality match COVID vaccination of pregnant women: Dr. McCullough Reveals More Bad News About the COVID Shots - The Vigilant Fox - 3rd November 2023
“We’re seeing a disturbing continued trend of cardiac arrests in people who have taken the vaccine,” reported world-renowned cardiologist Dr. Peter McCullough to Real America's Voice Friday. “Now we have data from Nakahara in a human cardiac PET study showing that positron emission tomography scans of the heart change in almost everybody who took the shot, at least for six months or longer, where the heart’s metabolism changes.” mRNA COVID Vaccines form Spike Protein in Heart Cells, but Cause Different Anomalies: Research Article - Epoch Health - 25th October 2023
New research out of Germany observing rat and human heart cells shows that within 48 hours of vaccination, the COVID-19 mRNA vaccines form spike proteins. Spike proteins, made from the mRNA instructions inside the vaccines, were detected in the heart cells. While both Pfizer and Moderna vaccines caused cell abnormalities, the two induced different anomalies. DNA fragments detected in monovalent and bivalent Pfizer/BioNTech and Moderna modRNA COVID-19 vaccines from Ontario, Canada: Exploratory dose response relationship with serious adverse events - OSFPreprints - 27th October 2023
"Conclusion: These data demonstrate the presence of billions to hundreds of billions of DNA molecules per dose in these vaccines. Using fluorometry, all vaccines exceed the guidelines for residual DNA set by FDA and WHO of 10 ng/dose by 188 – 509-fold. However, qPCR residual DNA content in all vaccines were below these guidelines emphasizing the importance of methodological clarity and consistency when interpreting quantitative guidelines. The preliminary evidence of a dose-response effect of residual DNA measured with qPCR and SAEs warrant confirmation and further investigation. Our findings extend existing concerns about vaccine safety and call into question the relevance of guidelines conceived before the introduction of efficient transfection using LNPs. With several obvious limitations, we urge that our work is replicated under forensic conditions and that guidelines be revised to account for highly efficient DNA transfection and cumulative dosing." Explosive Story: Health Canada Admits Pfizer Misrepresented Their COVID-19 Shot - Dr. Byram W. Bridle - 20th October 2023
I am astonished. Canada’s health regulatory agency has made a stunning admission about Pfizer’s COVID-19 shots. They seem to be grasping reality again; at least for an issue that is a big no-no in the regulation of novel medical products. Vaccinated Rat and Human Heart Cell Study Shows How Hearts Get Damaged - Substack - Igor Chudov - 18th October 2023
In a new laboratory research letter, scientists from the Giessen Institute of Physiology (Germany) and the National Heart Laboratory of Semmelweis University (Hungary) finally were able to pinpoint some mechanisms of how Covid vaccines damage hearts. COVID-19 vaccines immediate onset Autoimmune Disease adverse events in VAERS - Darrell O. Ricke, M.S., PH.D - Substack - 17th October 2023
This post focuses on 30+ autoimmune disease adverse events enriched following COVID-19 vaccinations. The VAERS data has the following limitations: (1) only a subset of actual adverse events are captured (estimated at 1 in 241 in the above article) and (2) reported adverse events include background frequency adverse events. DNA contaminants - an 'accident' too far? - HART - 10th October 2023
Kevin McKernan’s demonstration of high levels of DNA in the vaccine vials has now been replicated by six other laboratories globally. There are strict limits placed on the amount of DNA allowed because of the risk of this foreign DNA integrating into the human genome. Oddly the EMA limits the amount as a ratio with how much mRNA is present rather than giving an absolute amount. These higher levels were exceeded by 20-30 times. One Year of Nattokinase Yields Favorable Effects on Cardiovascular System - Substack - Peter McCullough - 8th October 2023
Today, nattokinase is widely used as a oral supplement in capsule form in Base Spike Detoxification to help degrade the long-lasting SARS-CoV-2 Spike protein for 3-12 months in patients suffering from symptoms of long-COVID after the infection or more commonly after mRNA vaccination. Because some of the higher risk long-COVID patients also have atherosclerotic cardiovascular disease, nattokinase has other important effects in the body. 5 ways to skin a (genetically modified) cat - Substack - Dr Ah Kahn Syed - 1st October 2023
By now I sincerely hope that you have all been watching the exposure of the PlasmidGate scandal unfold on twitter and various other platforms. If you haven’t I’m going to summarise it for you as briefly I can: Unvaccinated with Omicron Infection have Lowest Risk of Post-COVID Syndrome - Substack - Peter McCullough, MD - 28th September 2023
Post-COVID or “long-COVID” syndrome is a very real and miserable condition I see in clinical practice everyday. The billion dollar US HHS National Action Plan on Long COVID-19 for this condition does not take into consideration that mass genetic vaccination has loaded Spike protein into the bodies of Americans making them even more sick with symptoms of fatigue, hair loss, weakness, effort-intolerance, headaches, tinnitus, palpitations, labile blood pressure, and numbness/tingling. mRNA 'vaccines' must be banned once and for all - The Conservative Women - 29th September 2023
"THOSE of us who knew from the beginning that the sequence of CoV-SARS-2 contained inserts which could not have possibly occurred naturally, and were similar to ones that had already been published from the Wuhan laboratory, have had to endure unbelievable scorn, scientific ostracism and the ignominy of being ‘cancelled’ by the MSM as well as by professional colleagues for nearly three years now." The persistence of the people showing the persistence of modmRNA/spike in people - Jessica Rose - 28th September 2023Please refer to the publication hot-off-the-presses entitled: "Duration of SARS-CoV-2 mRNA vaccine persistence and factors associated with cardiac involvement in recently vaccinated patients".
It was published yesterday (September 27, 2023) in NPJ Vaccines (Nature). Former Major City Police Detective Reveals 50% of SIDS Cases Happened Within 48 Hours Post-Vaccine - Vigilant News - 27th September 2023
My 16-minute interview of Jennifer, a former police detective in a major US city who handled over 250 SIDS investigations over 7 years implicates the childhood vaccines as the major cause of SIDS. 'Risky Strategy': CDC Signs Off on Pfizer RSV Vaccine for Pregnant Women to Protect Newborns - The Defender - 25th September 2023
Cardiologist Peter McCullough, M.D., M.P.H., told The Defender, “Vaccination of the mother for passive immunization of the infant is an unnecessary and risky strategy that will undoubtedly lead to fetal loss or premature deliveries when deployed on a large scale.” COVID-19 vaccine-associated mortality in the Southern Hemisphere Correlation - Denis G. Rancourt - 17th September 2023
Seventeen equatorial and Southern-Hemisphere countries were studied (Argentina, Australia, Bolivia, Brazil, Chile, Colombia, Ecuador, Malaysia, New Zealand, Paraguay, Peru, Philippines, Singapore, South Africa, Suriname, Thailand, Uruguay), which comprise 9.10 % of worldwide population, 10.3 % of worldwide COVID-19 injections (vaccination rate of 1.91 injections per person, all ages), virtually every COVID-19 vaccine type and manufacturer, and span 4 continents. 2 In the 17 countries, there is no evidence in all-cause mortality (ACM) by time data of any beneficial effect of COVID-19 vaccines. There is no association in time between COVID-19 vaccination and any proportionate reduction in ACM. The opposite occurs. Safety data, unblinded trials and COVID-19 products in breast-feeding mothers, infants and pregnant women in the United States - Substack - Jessica Rose - 22nd September 2023
"There’s probably a reason why the original exclusion criteria list for the COVID-19 injectable product Phase III trials excluded breast feeding mothers and pregnant women. There’s also probably a reason we don’t want pregnant women to drink and smoke." SC Senate Hearing - Dr. Janci Lindsay - SC 4 Freedom - YouTube - 15th September 2023
Dr. Janci Lindsay testifies before South Carolina Senate Medical Affairs Ad-Hoc Committee on DHEC. SC Senate Hearing - USC Professor Dr. Phillip Buckhaults - SC 4 Freedom - YouTube - 13th September 2023
University of South Carolina Professor Dr. Phillip Buckhaults testifies before South Carolina Senate Medical Affairs Ad-Hoc Committee on DHEC. Viral RNA Can Persist for 2 Years After COVID-19: Preprint Study - Epoch Health - 19th Setpember 2023
A new study may explain why some people who get COVID-19 never return to normal and instead experience new medical conditions like cardiovascular disease, clotting dysfunction, activation of latent viruses, diabetes mellitus, or what’s known as “long COVID” after SARS-CoV-2 infection. CHD Report to Congress Addresses Censorship, Mandates and 'Distressing State of American Children's Health' - The Defender - 18th September 2023
Children’s Health Defense (CHD) last week sent a letter and report to the U.S. House Judiciary Select Subcommittee on the Weaponization of the Federal Government, highlighting the “unprecedented challenges” the organization has faced as a “direct result of unwarranted censorship and the profound impact it continues to have on our ability to address critical health and safety issues affecting the Nation.” COVID-19 Vaccines Revealed to Be 'Neither Safe, Nor Effective': Watchdog - Epoch Times - 17th September 2023
An investigation into COVID vaccines found that the jabs were “neither safe nor effective,” said the nonprofit National Citizens Inquiry (NCI) in a Sept. 15 post on X. The organization published a report Thursday detailing the flawed mechanism through which the vaccines were granted “approval” in Canada. The Real Purpose of the SV40 Promoter in Covid Injections - Substack - Sasha Latypova - 1st September 2023
The University of Rochester (NY) lab page quote: "Furthermore, we have demonstrated that portions of the 72 bp SV40 enhancer are required for the nuclear entry of plasmid DNA in all eukaryotic cells tested to date; plasmids not containing this sequence remain in the cytoplasm until cell division, whereas plasmids containing the enhancer migrate to the nucleus within several hours. These results demonstrate that transport of DNA into the nucleus is sequence-specific." New Study Detects Spike Protein in Vaccinated 6 Months After COVID-19 Vaccination: Researchers Suggest 3 Possible Reasons - Epoch Health - 12th September 2023
"Utilizing these techniques, researchers detected specific fragments of synthetic spike protein in about 50 percent of subjects who received mRNA vaccines. The synthetic spike protein was detected from 69 to 187 days following vaccination. All samples from the unvaccinated control group were negative, including the 20 individuals who had tested positive after contracting COVID-19." Andrew Bridgen: Parliament has been captured and people are going to have to say "no" and defend themselves - The Expose - 10th September 2023
In an interview with Canadian podcaster Maryann Gebauer, UK Member of Parliament Andrew Bridgen discussed Greater London’s controversial new Ultra Low Emission Zone (“ULEZ”) and the ongoing crisis being caused by proponents of the fabricated human-caused climate change agenda. Proof of mRNA Disaster! A Buried England mRNA Data Avalanche has been Exposed. We can now Compare the % of All Cause Death (by Vaccination Status) with the % of Vaccine Uptake - Substack - The Nobody who knows Everybody - 5th September 2023
The following charts show Vaccine Uptake rates of 18 years and over Adults in the population of “England” versus the percentage of all cause deaths represented by the different Vaccine Uptake Groups of that same population. Forensic Analysis of the 38 Subject Deaths in the 6-Month Interim Report of the Pfizer/BioNTech BNT162b2 mRNA Vaccine Clinical Trial - Preprints.org - 4th September 2023
"Most importantly, we found evidence of an over 3.7-fold increase in number of deaths due to cardiovascular events in BNT162b2 vaccinated subjects compared to Placebo controls. This significant adverse event signal was not reported by Pfizer/BioNTech. Potential sources of these data inconsistencies are identified." SARS-CoV-2 Spike amyloid fibrils specifically and selectively accelerates amyloid fibril formation of human prion protein and the amyloid B peptide - BioRxiv - 1st September 2023
"We here provide evidence of significant Spike-amyloid fibril seeded acceleration of amyloid formation of CJD associated human prion protein (HuPrP) using an in vitro conversion assay. By seeding the HuPrP conversion assay with other in vitro generated disease associated amyloid fibrils we demonstrate that this is not a general effect but a specific feature of spike-amyloid fibrils. We also showed that the amyloid fibril formation of AD associated Aβ1-42 was accelerated by Spike-amyloid fibril seeds. Of seven different 20-amino acid long peptides," Do 50% of Pfizer & Moderna-Vaccinated People Produce Spike Protein Forever? - Vigilant News - 2nd September 2023
Dr. William Makis reviews five studies on Spike protein in the blood. Several recent studies deal with spike protein in the blood and I will briefly review the following: The 'Pirola' Variant of SARS-CoV-2 - Dr. Byram W. Bridle - Substack - 31st August 2023A friend asked for my opinion about a story that was just published. Rather than provide only him with an answer, I figured that others might benefit from the insights of a viral immunologist who specializes in vaccinology, and that has been on the front lines of COVID-19 science since the beginning. Here is my take…
Pfizer's COVID Vaccine Causes VAIDS in Children, Study Proves - Igor Chudov - Substack - 29th August 2023
"Finally, we have scientific confirmation that vaccination against COVID-19 causes a marked decrease in immunity to heterologous pathogens such as viruses, bacteria, and fungi. This decreased immunity to other pathogens (acquired immune deficit) is what people colloquially refer to as “VAIDS.” (VAIDS stands for Vaccine-Acquired Immune Deficiency Syndrome)" Natural immunity is life-long and bullet-prooof, this study 'Neutralizing antibodies derived from the B cells of 1918 influenza pandemic survivors' published in NATURE (Yu et al.) showed 32 persons - Dr. Paul Alexander - Substack - 17th August 2023
‘Thus, these studies demonstrate that survivors of the 1918 influenza pandemic possess highly functional, virus-neutralizing antibodies to this uniquely virulent virus, and that humans can sustain circulating B memory cells to viruses for many decades after exposure—well into the tenth decade of life.’ COVID-19: Eris or Pirola? - Robert W Malone MD, MS - Substack - 22nd August 2023Don’t be conned.
When Pfizer Board of Director, Scot Gottlieb makes headline news that he is “pretty concerned” about this new variant, take a step back and remember his role in the “Twitter files”… How I Managed to Get Facts Published in USA Today - Epoch Health - 22nd August 2023
Now, the obvious reaction anyone should have after reading our published version is, “Why were the vaccines not mentioned as a possible cause in the article?” If you need me to explain why, I will be brief and blunt: The op-ed would NEVER have seen the light of day otherwise. Not in a million years." US nursing home data shows clearly that the COVID vaccines made the elderly MORE likely to die from COVID. Whoops! - Steve Kirsch - Substack - 20th August 2023
CMS publishes record-level nursing home data by week. When you analyze this data different ways, the conclusion is always the same: the vaccines were a disaster, increasing the death rate from COVID. 'The New Normal': Young Athletes Are Collapsing and Dying at Rates Never Seen Before - Rumble - The Vigilant Fox - 19th August 2023
What you're watching here is just from the past eight months... What the heck is going on? IgG4, CD4s and why the LNP/mRNA platform should be prohibited - Unacceptable Jessica - Substack - 14th August 2023
"Overactive Tfh cell immune responses have the potential to mount unwarranted germinal centers, composed of aberrantly mutated B cells that can drive antibody-mediated autoimmune diseases." What the "Casual Cruelty" of Dr. Paul Offit Reveals - Aaron Siri - 4th August 2023
In response to a Twitter exchange I had with Dr. Paul Offit, he penned an article titled The Casual Cruelty of Placebo-Controlled Clinical Trials that makes numerous categorically false claims to argue against proper clinical trials for products injected into babies. Please make them stop the insanity of using nearly all newborns as guinea pigs - CDC's ACIP today voted unanimously to give a monoclonal antibody to newborns on day 1-7 of life to prevent RSV - Meryl Nass - 4th August 2023I previously revealed a published CDC paper from 2021 that showed only 25 babies up to one year of age die from RSV yearly in the entire US, averaged over 12 years. This is death certificate data, which CDC collects. It is considered THE GOLD STANDARD.
Relapsing myocarditis following initial recovery of post COVID-19 vaccination in two adolescent males - Case reports - PubMed - August 2023
"These case reports outline the need of strict follow-up in patients with CMR consistent with myocarditis after mRNA-based-COVID19 vaccine. More efforts are necessary to depict the underlying mechanisms of myocarditis after SARS-CoV2 vaccination to understand the risk of relapsing and the long-term sequelae." Heart Scarring Observed in Children Months After COVID-19 Vaccination: Study - Epoch Health - 5th August 2023
They said the implications of the persistence remain unclear but that given it’s an indicator of subclinical heart dysfunction and scarring, “there exists a potential long-term effect on exercise capacity and cardiac functional reserve during stress.” Cardiac Mortality Up During 28 Days after COVID-19 Vaccination in Self-Controlled Studies from England, Italy, United States - Peter McCullough, MD - Substack - 7th August 2023
"Compared to the longer-term of observation over 25 months, the first 28 days carried a pooled hazard ratio (HR) suggesting that COVID-19 vaccination is associated with an increased risk of cardiac-related mortality (HR = 1.06, 95% CI [1.02, 1.11], p = .007). Subgroup analysis showed that male gender is significantly associated with increased risks of cardiac mortality (HR = 1.09, 95% CI [1.02, 1.15],= .006)." New Research Validates Autism's Link to Gut - Epoch Health - 31st July 2023
Researchers have identified a microbial signature for autism spectrum disorder, a critical finding that offers clarity about how the gut microbiome influences this neurological syndrome. The data-driven study published by 43 researchers challenges the idea that autism is a primarily genetic condition and suggests that environmental factors may be behind the sharp rise in the debilitating condition. Measles: Unvaccinated not to Blame for Outbreaks + Other Fun Facts - The Defender - 28th July 2023
As measles vaccine efficacy drops, increased measles cases are expected regardless of vaccination rates or responsibility attributed. Periodic outbreaks shouldn't restrict civil liberties. COVID-19 Vaccines and Boosters Were Never Made With mRNA - Epoch Health - 27th July 2023
For the first time in human history, the gene regulatory program of healthy people has been manipulated on a massive scale. Despite everything we’ve been told, RNA-based COVID-19 injections were manufactured with modified RNA—not messenger RNA (mRNA). Modified RNA (modRNA) poses substantial risks to our health. These risks come not only from COVID-19 injections and boosters but—unless we speak up now—also from all future RNA-based vaccines. Neonatal, Infant, and Under Age Five Vaccine Doses Routinely Given in Developed Nations and Their Association With Mortality Rates - Cureus - 20th July 2023
Conclusions There are statistically significant positive correlations between mortality rates of developed nations and the number of early childhood vaccine doses that are routinely given. Further investigations of the hypotheses generated by this study are recommended to confirm that current vaccination schedules are achieving their intended objectives. Risk of Stroke Skyrockets with COVID-19 Infection after Vaccination - Peter McCullough, MD - Substack - 23rd July 2023
"Nahab and coworkers from Emory analyzed a statewide database of COVID-19 vaccine recipients. Approximately 5 million adult Georgians received at least one COVID-19 vaccine between December 2020 and March 2022: 54% received BNT162b2, 41% received mRNA-1273, and 5% received Ad26.COV2.S. Those with concurrent COVID-19 infection within 21 days post-vaccination had an increased risk of ischemic (OR = 8.00, 95% CI: 4.18, 15.31) and hemorrhagic stroke (OR =5.23, 95% CI: 1.11, 24.64)." NextCOVE trial contravenes the Declaration of Helsinki - HART - 19th July 2023
"We wish to draw your attention to a Covid-19 vaccine trial in your hospital which has just started recruiting children aged 12-17 and which is in contravention of the Declaration of Helsinki and other UK and international laws." After Long Silence on 'Long Vax,' Science Magazine Links Autoimmune Disorders to COVID Shots - Epoch Health - 18th July 2023
Mainstream publications and regulatory agencies have buckled to public pressure to admit the COVID-19 vaccine can cause injuries such as myocarditis and pericarditis—but until recently, they’ve published little or nothing about the substantial number of people suffering from autoimmune disease after vaccination. Robert F. Kennedy Jr Just Torched the COVID Narrative - Rumble - Chief Nerd - 20th July 2023
"Trusting the experts is not a function of science. It is not a function of democracy. It is a function of religion and totalitarianism, and it does not make for a healthier population." CDC Reports: More than 1 in 10 Boys Have ID, ASD, or Another Developmental Delay - Safe Minds - 17th July 2023
Among Both Sexes, Ages 3-17, 8.56% Have Been Diagnosed with a Developmental Disability A new Centers for Disease Control and Prevention (CDC) report shows that the percentage of American children who have been diagnosed with a developmental disability has increased, with now more than 1 in 10 boys having an intellectual disability (ID), autism spectrum disorder (ASD), or another developmental delay. The Rise of POTS in the COVID-19 and Vaccine Era - Epoch Health -17th July 2023
The COVID-19 pandemic casts a concerning shadow in the form of Postural Orthostatic Tachycardia Syndrome, or POTS. This perplexing health issue, marked by a significant surge in heart rate when standing, is gaining increasing attention in the medical community due to a rise in cases. What Happens to Vaccine Clinical Trial Participants? - A Midwestern Doctor - Substack - 16th July 2023Almost every abusive relationship follows a similar pattern: the abusive partner lures the abused party into the relationship with lavish promises, and then once they are ensnared, finds reasons to renege on those promises and justifications to be a little bit abusive. The abused party will try to resist this shift, but the abuser will find some way to overcome that resistance (e.g., they will gaslight the partner into believing the abuse isn’t even happening).
Ed Dowd: 'They Can't Run From This Data' - CHD.TV - 14th July 2023
“This is the greatest cover-up I’ve ever seen in my life.” Disability claims are on the rise, and people are wondering why. “If it's not the vaccine, what is it?” asks Ed Dowd in this episode of ‘Friday Roundtable.’ He also states, “Some people are going to be, unfortunately, producing spike protein their whole lives.” Hear from Ed on CHD.TV! Cognitive Impairment in Adults - What Role Did COVID
Vaccines Play? - Igor Chudov - 11th July 2023 A month ago, I mentioned evidence (provided by the Dutch Institute RIVM) of a dramatic increase in cognitive problems among adults: Coming Full Circle on Cancer and Extrachromosomal DNA - NIH - National Cancer Institute - 10th May 2023
"A new study has brought researchers a step closer to understanding the role an unusual form of DNA can play in cancer. This form of DNA—called extrachromosomal DNA (ecDNA)—doesn’t reside on chromosomes, the long tendrils of tightly packaged DNA found inside the nucleus of cells. Instead, circular ecDNA particles float around the nucleus like a child’s lost inner tube in a swimming pool." No Glucose? Pancreatic Cancer May Have a Ready Energy Alternative - NIH National Cancer Institute - 22nd June 2023
"In the study, funded in part by NCI, an international research team showed that pancreatic cancer cells appear to have a potent strategy for overcoming this glucose deprivation: They use an alternative source of fuel, a molecule called uridine." 'Long Vax' Confirmed? Researchers Begrudgingly Admit Connection Between 'Long Covid' Symptoms & Vaccines - Kyle Becker - 5th July 2023
Covid vaccine recipients are reporting a rare but growing phenomenon of adverse symptoms, which range from unusual blood clotting and heart inflammation to a more ambiguous set of symptoms similar to those of Long Covid, which has been dubbed “Long Vax” by some. Some Children Suffered Seizures Following mRNA COVID Shots - The Vaccine Reaction - 4th July 2023
A 2023 analysis published by researchers from Kaiser Permanente and the U.S. Centers for Disease Control and Prevention (CDC) in the journal Pediatrics compared vaccine adverse outcomes following administration of Pfizer/BioNTech’s Comirnaty messenger RNA (mRNA) COVID-19 shot and Moderna/NIAID’s Spikevax mRNA COVID-19 shot among recipients under five years old for a period of 1-21 days post-vaccination, compared to outcomes among those vaccinated 22-42 days post-vaccination. The authors reported that 104 children under the age of five suffered seizures after receiving an mRNA COVID shot. Ontological and Existential Shock - Robert Marlone MD, MS - 4th July 2023
In contrast, “Ontological Shock” involves one or more events which cause one to question an internal model of how the world works, what is true and untrue, and to question previously held assumptions relating to trust, teaching, and learned models of physical reality and history - interpretation of the tide of events which flow through our lives and provide key event “meanings” which we rely upon to assemble our internal models of what is true and what is false. I suggest that “Ontological Shock” is the more appropriate term to describe the experience of encountering the lies, censorship, propaganda and misdeeds of those responsible for gross mismanagement of the COVIDcrisis." German Scientists Uncover Evidence that EU Pfizer-BioNTech Batches Included Placebos - Brownstone Institute - 1st July 2023
German scientists have uncovered startling evidence that a substantial portion of the batches of the Pfizer-BioNTech Covid-19 vaccine deployed in the European Union may in fact have consisted of placebos – and hence were not even subjected to quality-control testing by the German agency which was in principle responsible for approving their release. Why the COVID-19 Vaccines Could Never Prevent Transmission - A Midwestern Doctor - 24th June 2023
Recently, the lies conducted to push the vaccines have been brought back to the public’s attention. This is partly because of the numerous videos now circulating that show just how many times a spokesman for them contradicted himself while making false promises about the vaccines to sell them to the American public on national television (which he later denied ever claiming) and partly because recent FOIA disclosers again proved our the officials who pushed the vaccines were not transparent with the public. Immune Dysregulation in Autism Spectrum Disorder: What Do We Know about it? - Peter A. McCullough, MD, MPH - Substack 20th June 2023
The race is on to find determinants or risk factors for autism that could be modified or eliminated in order to stem the tide of new cases. One of the hottest areas of research is immune dysregulation causing changes during the development of the human brain that result in the expression of autism spectrum disorder. Do Vaccines Make Us Healthier or Sicker Over Time? (Three Independent Studies Weigh In) - Rumble - Sunfellow On Covid-19 - 20th June 2023
Three independent studies on childhood vaccination, released in 2020, compared the overall health of vaccinated and unvaccinated people and the results are striking! In case you thought getting more shots was a good idea... Jessica Rose - Substack - 17th June 2023
A new preprint is out entitled: "Risk of Coronavirus Disease 2019 (COVID-19) among Those Up-to-Date and Not Up-to-Date on COVID-19 Vaccination“ and it concludes from a multivariate analysis of 48,344 individuals (Employees of Cleveland Clinic) that ‘those not “up-to-date” on COVID-19 vaccination had a lower risk of COVID-19 than those “up-to-date”’. Crooks Who Approved "Covid Vaxx" approved Other "Childhood Vaccines" Also - Igor Chudov - Substack - 15th June 2023
I was listening to the FDA VRBPAC hearing today, and I heard someone say that “Covid vaccine is as safe and effective as childhood vaccines”. I said, hm, if “Covid Vaccine”, which is dangerous and actually invites Covid, is as good (or as bad) as other childhood vaccines, why can’t I take a look at those vaccines also? I gave my kids all childhood vaccines except the flu shots, after all. Was I wrong to agree to give them those shots? Kevin McKernan Presents Evidence of COVID Vaccine Contamination to the FDA VRBPAC Committee - Rumble - Chief Nerd - 16th June 2023
"The Pfizer vaccines specifically had this SV40 promotor which was not disclosed in the expression vector map that was given to the EMA" Want to compromise brain activity? Just add SARS-CoV-2 spike! - Jessica Rose - Substack - 12th June 2023
This latest paper published in Science Advances on June 7, 2023 entitled: "Sars-CoV-2 Infection and viral fusogens cause neuronal and glial fusion that compromises neuronal activity" confirms some disturbing theories as to why we have been witnessing neurological impairment and damages since SARS-CoV-2 was introduced to the public. Green Monkey DNA Found in COVID-19 Shots - Epoch Health - 11th June 2023
The COVID-19 shots are turning out to be more of a time bomb than ever imagined. This new discovery of the presence of green monkey DNA, including tumor-linked viral promoters, in the jabs has this microbiologist and immunologist calling for an immediate halt in the use of mRNA “vaccines.” Nuclear permeability during cell division - Anandamide - Substack - 5th June 2023
In late May I had the honor of speaking with Sucharit Bhakdi, MD regarding dsDNA contamination in the vaccines. First, we need to do some numbers. The 100ug Moderna shots deliver over 40 trillion mRNA molecules (14T for Pfizer) and the number of LNPs per shot is reported to be 10-50 billion. For easy math, lets assume 40 billion LNP's This is roughly 1,000 mRNAs in each LNP. Association between Childhood Hyper-vaccination and Autism - Dr Peter A. McCullough, MD, MPH - Principia Scientific - 7th June 2023
Throughout the pandemic we have heard the tenuous phrase “correlation is not causation.” I can tell you as an epidemiologist, we always look at the strength and consistency of associations in addition to many other factors in the evaluation of determinants of disease. In the 1970s, the rate of autism was 1 in 10,000 and the rate today has exploded to 1 in 36. EL GATO MALO: excellent piece by EL GATO. "Farewell Questions for Rochelle Walensky" - Dr. Paul Alexander - Substack - 5th June 2023
Just what was this “Data from the CDC today” that suggested that “Vaccinated people do not carry the virus?” Did we have data to show clearly vaccinated had massive viral loads and spread it? 100% How Did Our Vaccine Oversight System Get So Broken? - Aaron Siri - 4th June 2023I was asked to testify before the Arizona State Legislature regarding several topics related to Covid-19 vaccines. So, last week, I did just that. I had a lot to say and got to say it on a panel that included the heads of the Arizona Senate and House health committees.
NAC's protective capacity against Engineered Nanoparticles (ENPS) toxicity - Outraged Human - 30th May 2023
"In this study, we gained new insights into the epigenotoxicity of ENPs, demonstrating that they alter global DNA methylation levels and DNA methylation levels of TEs via a mechanism that is independent of oxidative stress. Moreover, we proved that NAC can attenuate ENP-induced DNA hypomethylation." COVID vaccines have likely caused over 25,000 new cases of multiple sclerosis (MS) - Steve Kirsch- Substack - 29th May 2023A paper abstract that appeared on the WHO webstie created quite a stir because it showed the biological mechanism for how COVID vaccines can induce multiple sclerosis.
Note: the link takes you to a “fact check” proving the abstract was on the WHO website because the WHO removed it after people noticed it. Estimation of Excess Mortality in Germany During 2020-2022 - Cureus - 23rd May 2023
Results The results show that the observed number of deaths in 2020 was close to the expected number with respect to the empirical standard deviation; approximately 4,000 excess deaths occurred. By contrast, in 2021, the observed number of deaths was two empirical standard deviations above the expected number and even more than four times the empirical standard deviation in 2022. In total, the number of excess deaths in the year 2021 is about 34,000 and in 2022 about 66,000 deaths, yielding a cumulated 100,000 excess deaths in both years. The high excess mortality in 2021 and 2022 was mainly due to an increase in deaths in the age groups between 15 and 79 years and started to accumulate only from April 2021 onward. A similar mortality pattern was observed for stillbirths with an increase of about 9.4% in the second quarter and 19.4% in the fourth quarter of the year 2021 compared to previous years. Strategies for the Management of Spike Protein-Related Pathology - MDPI - 17th May 2023
In the wake of the COVID-19 crisis, a need has arisen to prevent and treat two related conditions, COVID-19 vaccine injury and long COVID-19, both of which can trace at least part of their aetiology to the spike protein, which can cause harm through several mechanisms. One significant mechanism of harm is vascular, and it is mediated by the spike protein, a common element of the COVID-19 illness, and it is related to receiving a COVID-19 vaccine. IgG4 Antibodies Induced by Repeated Vaccination May Generate Immune Tolerance to the SARS-CoV-2 Spike Protein - MDPI - 17th May 2023
"However, emerging evidence suggests that the reported increase in IgG4 levels detected after repeated vaccination with the mRNA vaccines may not be a protective mechanism; rather, it constitutes an immune tolerance mechanism to the spike protein that could promote unopposed SARS-CoV2 infection and replication by suppressing natural antiviral responses. Increased IgG4 synthesis due to repeated mRNA vaccination with high antigen concentrations may also cause autoimmune diseases, and promote cancer growth and autoimmune myocarditis in susceptible individuals." Are Childhood Vaccines Safe? DTP Vaccine Was Not - and Was Given for Decades! - Igor Chudov - Substack - 26th May 2023
The Covid vaccine debacle woke up many people, myself included. Many of us were shocked to see a novel, unproven treatment promoted aggressively with false promises given to us and mandates imposed on young and healthy persons. Those mRNA formulations ended up not working and caused thousands of deaths, despite repeated assurances of safety and effectiveness given by charlatans pretending to “represent science.” Groups Lobbying for COVID-19 Vaccine Mandates Were Funded by Pfizer - The Epoch Times - 3rd May 2023
Multiple organizations that pushed for COVID-19 vaccine mandates received funding from Pfizer, according to financial disclosures. When Chicago Urban League President Karen Freeman-Wilson said in August 2021 that the benefit of mandates “far outweighs” concerns about them, she didn’t mention that her organization had received a $100,000 grant for a “vaccine safety and effectiveness campaign,” according to a Pfizer disclosure. GlyNAC (Glycine and N-Acetylcysteine) Supplementation in Old Mice Improves Brain Glutathione Deficiency, Oxidative Stress, Glucose Uptake, Mitochondrial Dysfunction, Genomic Damage, Inflammation and Neurotrophic Factors to Reverse Age-Associated Cognitive Decline: Implications for Improving Brain Health in Aging - MDPI - 4th May 2023
Conclusions The results of this study provide proof-of-concept that GlyNAC supplementation improves age-associated cognitive decline and supports brain health in aging by improving/correcting brain GSH deficiency, elevated OxS, mitochondrial dysfunction, abnormal mitophagy and autophagy, inflammation, impaired glucose transport/uptake, elevated genomic damage, and reversing the decline in brain neurotrophic growth factors. GlyNAC could be a simple and effective nutritional supplement to support brain health and cognitive function in aging, and warrants additional investigation. CHD.TV Exclusive With Geert Vanden Bossche - Childrens Health Defense - 24th April 2023
Excerpts from a sit-down CHD.TV Exclusive interview with virologist Geert Vanden Bossche The illusion of vaccine efficacy revisited - Norman Fenton and Martin Neil - Substack - 2nd May 2023
"This example simulates a vaccine roll-out and efficacy evaluation which is essentially how all the 2021 observational studies of the covid vaccines were conducted." Novel Movement Disorders After COVID Vaccination: Patients Misdiagnosed, Treatment Delayed - Epoch Health - 2nd May 2023
In this series, we evaluate some of the lesser-known yet common COVID-19 vaccine adverse events that are appearing in the research literature as well as in doctors’ clinics and, more importantly, how to deal with them and reduce the risks. The Novelty of mRNA Viral Vaccines and Potential Harms: A Scoping Review - MDPI - 17th April 2023
"Considering the lack of data on the platform itself, we recommend a robust, independent, and wide-ranging safety audit of mRNA–LNP formulations and call on regulators to hold manufacturers to high safety standards, especially for products used prophylactically in the general population." Covid Reckoning is Underway: Texas to Join Florida in Investigating Big Pharma and "Covid Science" Fraud - Igor Chudov - Substack - 1st May 2023
Will Truth and Justice Prevail, After All? I am thrilled to report that the “Covid reckoning” we hoped for is underway. The state of Texas is joining the bandwagon. Report 69: BOMBSHELL - Pfizer and FDA Knew in Early 2021 That Pfizer mRNA COVID "Vaccine" Caused Dire Fetal and Infant Risks, Including Death. They Began an Aggressive Campaign to Vaccinate Pregnant Women Anyway. - DailyClout - 29th April 2023
"This document is among the most horrifying yet to emerge into public view. It reveals that both Pfizer and the FDA knew by early 2021 that Pfizer’s mRNA COVID vaccine, BNT162b2, resulted in horrible damage to fetuses and babies. (Though I arrived at the conclusions in this article on my own from reviewing the document linked here," LNP packaging of dsDNA - Anandamide - Substack - 26th April 2023
"This demonstrates the article written on this topic by ORFonline is false. They equated this to ‘Entering a Fortress’. If the DNA is packaged in LNPs then it will be delivered to the cells with the mRNA and much of the DNA may be in RNA:DNA hybrids. I doubt Pfizer or Moderna would claim LNPs are faced with ‘Entering a Fortress’. The whole point of LNP packaging is to provide nuclease protection and easy entrance to the fortress. ORFonline’s argument is thus overt gaslighting as a Person of Ordinary Skill In The Art (POSITA) would assume the DNA is co-packaged with the RNA unless you provided sufficient evidence to counter the Occam’s razor of this manufacturing assumption." New JCVI advice for high risk 0-4s - HARTGroup - 23rd April 2023
HART has spent the last two years explaining why it never made sense to vaccinate young people. We have been horrified as the vaccine has been extended to ever younger age groups even as covid has become significantly milder. We have repeatedly written to the JCVI asking for their justifications. No satisfactory or comprehensive response has ever been received. Coronavirus-HIV Mutants Were Discussed in NIH-funded Work that Led to COVID-19 - Igor Chudov - 23rd April 2023
Are you okay with "Airborne AIDS" Mutants, and Can we "Trust the Science"? This post will introduce new evidence (published two days ago) of HIV/Sars mutant coronavirus chimeras discussed in NIH-funded research projects that led to the COVID pandemic. The research project discussed in this post was funded by NIH grant 1R01AI110964 and was titled "Understanding the Risk of Bat Coronavirus Emergence." Grant 1R01AI110964 was given for research conducted by EcoHealth Alliance in cooperation with Dr. Ralph Baric of UNC and the Wuhan Institute of Virology. RNA-Based Vaccine Technology: The Trojan Horse Did Not Contain mRNA - Epoch Health - 21st April 2023
It Contains modRNA That Genetically Manipulates Healthy Cells "Furthermore, modified RNA-based “vaccines” are not vaccines but gene-based injections that force healthy cells to produce a viral protein. In this article, we will look at the uses and dangers of modRNA." Safe and Effective? - Perseus.org.uk - April 2023
This report has been co-authored by a multidisciplinary team of experts from various fields including medicine, safety management and pharmaceutical regulation. Its purpose is to bring to the attention of politicians and policy makers the serious shortcomings in the current regulatory system for drug approvals in general and the Covid-19 vaccines in particular, and the significant safety issues that result. Implications of Non-Specific Effects for Testing, Approving, and Regulating Vaccines - Springer - 19th April 2023
"The current framework for testing and regulating vaccines was established before the realization that vaccines, in addition to their effect against the vaccine-specific disease, may also have “non-specific effects” affecting the risk of unrelated diseases. Accumulating evidence from epidemiological studies shows that vaccines in some situations can affect all-cause mortality and morbidity in ways that are not explained by the prevention of the vaccine-targeted disease." Dr Paul Offit, MD. FDA advisor, said the 1) Bivalent Boosters failed & came up with a bogus reason!. - Dr. Paul Alexander - Substack - 19th April 2023
The science I have been reporting said it failed too; altogether, the bivalent booster BA 4/5 is a complete abject FAILURE! ‘On October 24, 2022, David Ho and colleagues released the results of a study examining levels of neutralizing antibodies against BA.4 and BA.5 after receipt of a monovalent or bivalent booster dose. They found “no significant difference in neutralization of any SARS-CoV-2 variant,” including BA.4 and BA.5, between the two groups. Excess Deaths Back With a Vengeance in the UK and Germany - Igor Chudov - Substack - 17th April 2023
This is a quick update on excess mortality - the deaths occurring in heavily vaccinated countries at rates exceeding historical averages. The Great COVID-19 Vaccine Bribe - John Leake - Dr. Peter A. McCullough MD - Epoch Health - 15 April 2023
Many readers of this Substack have doubtless wondered why their “health care providers”—i.e., doctors, repeatedly exhorted them to get the COVID-19 vaccines and boosters. In my extended social circle, I heard many reports of doctors being downright pushy about it—as though getting the COVID-19 vaccine was the single most pressing matter of medicine and health. FDA Chief Blames "Misinformation" for Declining Life Expectancy - Igor Chudov - Substack - 14th April 2023
On this Substack, we discussed and explored what could explain the mysterious "excess mortality" plaguing Covid-vaccinated countries. Fortunately for us, the FDA Commissioner Robert Califf has the answer: excess mortality, also known as reduced life expectancy, is caused by “misinformation”! BBC Veers From Official Narrative, Reports on AstraZeneca Vaccine Injuries and Lawsuit Against the Drugmaker - The Defender - 11th April 2023
In a departure from its largely pro-COVID-19 vaccine coverage of the past several years, the BBC — Britain’s national broadcaster — is covering news that AstraZeneca is facing lawsuits over claims the drugmaker’s COVID-19 vaccine caused injuries and deaths. SARS-CoV-2 Spike Protein Accumulation in the Skull-Meninges-Brain Axis: Potential Implications for Long-Term Neurological Complications in post COVID-19 - BioRxiv - 4th April 2023
"Our results revealed the accumulation of the spike protein in the skull marrow, brain meninges, and brain parenchyma. The injection of the spike protein alone caused cell death in the brain, highlighting a direct effect on brain tissue. Furthermore, we observed the presence of spike protein in the skull of deceased long after their COVID-19 infection, suggesting that the spike’s persistence may contribute to long-term neurological symptoms." Huge Veterans Study: COVID and FLU Vaccines are Useless at Preventing Hospitalization - Igor Chudov - Substack - 9th April 2023
Snake oil would work just as well as those "vaccines" but would be far safer SUMMARY: This post will show that both flu and Covid vaccines are utterly useless at preventing hospitalization for Covid AND flu. This conclusion is based on a recent large study of US veterans. Their health data is available to researchers from the Veterans Administration medical database. What are the risks and benefits of each vaccine? - A Midwestern Doctor - Substack - 5th April 2023
The COVID-19 vaccines have provided a once-in-a-lifetime opportunity to answer this question. A major problem I see throughout the scientific and political sphere is that people cannot maintain a perspective that allows them to see the whole picture; rather they tend to focus or fixate on things they have some type of emotional or subconscious priming to focus on (this has been an issue throughout history). How the 'hermit kingdom' became the world's control group for the largest vaccination trial ever - Umberella News - 28th March 2023
Isolated from the rest of the world, the Australian state of Western Australia (WA) managed to keep Covid out for most of 2021. During that time, almost four million doses of Covid vaccine were administered to the population. WA’s vaccine safety surveillance report for 2021 has just been released and the results are grim: an ‘exponential increase’ in adverse events, with hospitals struggling to cope. RNA Vaccine Clinical Trials - Robert W. Malone MD, MS - Substack - 1st April 2023"
CBER decided that going forward, with new mRNA vaccine trials, ONLY the product (the final formulation) should be tested as long as same manufacturing process and LNP are used. This is despite the fact that CBER did not do complete biodistribution or toxicity studies on these products, as discovered in the FOIA Japanese pre-clinical package and the US court ordered document release." Celastrol suppresses humoral immune responses and autoimmunity by targeting the COMMD3/8 complex - ScienceImmunology - 31st March 2023
"Celastrol, a bioactive molecule extracted from the Tripterygium wilfordii plant, has been shown to exhibit anti-inflammatory properties. However, its mechanism of action has not been fully elucidated. Here, we show that celastrol suppresses humoral immune responses and autoimmunity by disabling a protein complex consisting of copper metabolism MURR1 domain–containing (COMMD) 3 and COMMD8 (COMMD3/8 complex), a signaling adaptor for chemoattractant receptors." Court Orders Merck to Turn Over Gardasil Adverse Event Databases - The Defender - 3rd April 2023
A North Carolina district court ordered pharmaceutical giant Merck to turn over all of its Gardasil adverse event databases to plaintiffs suing the pharmaceutical giant for injuries allegedly caused by the HPV vaccine. This UK British government's report 42 stunned the medical community stating that N antibody levels were lower if infected after 2 vaccines -
Dr. Paul Alexander - Substack - 3rd April 2023 "So as a reminder, it was not only that the mRNA technology shot was not sterilizing the virus by stopping infection, replication, or transmission, but it was also damaging the underlying immune system in preventing it from inducing ‘conserved’ nucleocapsid protein antibodies. This means development of bullet proof robust natural immunity was being subverted." The Ballistics Report Is In: Pfizer Lot FL8095 Murdered 2 and Injured 1262 Children - Sasha Latypova - Substack - 31st March 2023
Update: I know the 2 death reports for children maybe a duplicated report. However, they have different VAERS IDs, and it is not my job to clean up VAERS. It is CDC’s job for which they get our money, and then proceed to deny the deaths and injuries documented in the database.Kevin McKernan has reported extensively on the results of sequencing analyses from Pfizer and Moderna vials. Renz Missouri House Testimony - BioTech Admits Gate's GMO Factory Food IS a Gene Therapy - Tom Renz - Substack - 25th March 2023
Plus the CDC KNEW the Vax Kills 1000+ per day! This has been a monumental week for the truth and freedom movement in our ongoing war against the WEF/CCP/Gates Foundation/etc. Here are just a few highlights: UK Oncologist warns Cancers are rapidly developing post-Covid Vaccination - " I am experienced enough to Know this is not coincidental" - The Expose - 27th March 2023
Dr. Angus Dalgleish, a renowned oncologist practising in the UK, recently wrote an open letter to the editor-in-chief of the medical journal The BMJ, urging the journal that harmful effects of Covid injections be “aired and debated immediately” because cancers and other diseases are rapidly progressing among “boosted” people. COVID-19 Vaccine Efficacy Grossly Overestimated from Non-Randomized Studies - Peter A. McCullough, MD, MPH - Substack - 29th March 2023Multiple Sources of Bias Created Illusion that Vaccines Worked as they Failed in the Real World
Proponents of COVID-19 mass vaccination will admit the products are not perfect yet claim they saved “millions of lives.” Major therapeutic claims such as mortality reduction with a single novel product can only be made on the basis of large, prospective, randomized, double-blind, placebo-controlled randomized trials with proper primary endpoints. Non-randomized studies have threats to validity that cannot be overcome. miRNAs as biomarkers of autism spectrum disorder: a systematic review and meta-analysis - Springer - 3rd February 2023
Several studies show that microRNAs (miRs/miRNAs) are strongly implicated in the development of the disorder and affect the expression of genes related to different neurological pathways involved in ASD. The present systematic review and meta-analysis addresses the current status of miRNA studies in different body fluids and the most frequently dysregulated miRNAs in patients with ASD. Ralph Baric's Description of the "Perfect Bioweapon" Sounds Awfully Similar to Sars-CoV-2 - Igor Chudov - 25th March 2023
Those "HIV Inserts" in Sars-CoV-2 are not just random sequences after all. I also explain that Sars-Cov-2 matches Ralph Baric’s description of his “perfect bioweapon” - a medium pathogenicity designer recombinant virus whose purpose is to create fear. Dr. Mike Yeadon: 3 Pieces of Evidence That COVID Vaccine Mandates Have Nothing To Do With Health - Rumble - Sunfellow On Covid-19 - 26th March 2023
If this were about public health, there would be three groups you would not inject with these so-called vaccines: 1. Those who have been infected and recovered. There is no dispute, not even with governments and their advisors, that those people are now immune. 2. Pregnant women. Thalidomide has shown us that developing fetuses are not protected in a mother's womb but, in fact, at certain points are very vulnerable to external chemical threats. 3. Healthy youngsters. Scientists still can't seem to find a previously healthy child who contracted COVID and died because of it.Dr. Mike Yeadon: "If this was to do with public health, you wouldn't have done any of the things they're doing -- and you can't come up with a benign explanation." Episode 312: Banking On Our Future - the Highwire - 23rd March 2023Banking Crisis On The Horizon?; States Mount Opposition to Federal Digital Currencies; German Network Profiles Vaccine-Injured HighWire-Style, German Health Minister Folds; This Doctor, and A-list Celebrity are on a mission to create the ‘home life’ for adults with Autism, and other special needs; Positive Development on HPV Vaccine Mandate Bill in CA.
Rates of autism climb to new highs in the U.S., with California setting record numbers - EurekAlert - 23rd March 2023
New Jersey’s rate of 8-year-olds diagnosed with autism spectrum disorder is the third-highest in the nation. According to the U.S. Centers for Disease Control and Prevention (CDC), about 4 percent of 8-year-old boys and 1 percent of 8-year-old girls, have autism in the U.S. These estimates are the highest since the CDC’s Autism and Developmental Disabilities Monitoring (ADDM) Network was created in 2000. Edward Dowd Presents Irrefutable Evidence Vaccine Mandates Killed & Disabled Countless Americans - Rumble - The Vigilant Fox - 20th March 2023
“Unless we have a new virus that knows you’re working, there’s no explanation for it.” Central Venous Thrombosis of the Brain after SARS-CoV-2 Infection and mRNA Vaccination - Peter A. McCullough, MD, MPH - Substack - 18th March 2023
Neurologic Disaster is Even Worse After Injection "Proponents of COVID-19 mass vaccination acknowledge that similar disastrous outcomes occur with both SARS-CoV-2 infection and the COVID-19 vaccines (myocarditis, blood clots, neurological problems). They position a tradeoff and suggest you should risk it with the vaccine in hopes its lower than that of the infection." What Really Happened Inside the COVID-19 Vaccine Trials? - A Midwestern Doctor - Substack - 13th March 2023
"One strategy used by Big Pharma to gaslight those injured by pharmaceuticals is to insist that there is no data linking the injury to the drug. Frequently however, these injuries were, in fact, observed in the trial but simply covered up to create the illusion the pharmaceutical was safe" Functional SARS-CoV-2 cross-reactive CD4 T cells established in early childhood decline with age - PNAS - 14th March 2023
Our results provide evidence that functional pre-existing SARS-CoV-2-reactive memory CD4+ T cells are elicited in early childhood and linked to seroconversion with the seasonal coronavirus OC43 but not many other viral infections. Compared to other viruses, the high OC43 seroprevalence at age two indicates that memory responses to coronaviruses develop at a young age. Coronavirus (COVID-19) Update: FDA Authorizes Vivalent Pfizer-BioNTech COVID-19 Vaccine as Booster Dose for Certain Children 6 Months through 4Years of Age- FDA - 14th March 2023
Today, the U.S. Food and Drug Administration amended the emergency use authorization (EUA) of the Pfizer-BioNTech COVID-19 Vaccine, Bivalent to provide for a single booster dose of the vaccine in children 6 months through 4 years of age at least 2 months after completion of primary vaccination with three doses of the monovalent (single strain) Pfizer-BioNTech COVID-19 Vaccine. Bombshell from Germany's Federal Minister of Health - Dr. Byram W. Bridle - Substack - 14th March 2023
Admits Severe COVID-19 'Vaccine' Injuries Have Always Exceeded What Canada Deemed to be Program-Ending !!!!! FDA and CDC Assertions in Doubling Down on COVID-19 Vaccination - Peter A. McCullough, MD, MPH - 12th March 2023
I am frequently asked: why are the government agencies still pushing COVID-19 vaccination after there have been calls in the US Senate and all around the world to pull them off the market for lack of safety and efficacy? Immunization/injecting with 674-685 fragment of SARS-CoV-2 spike protein induces neuroinflammation and impairs episodic memory of mice (Dr Henry Ealy shared with me); post COVID memory impairment
- Dr. Paul Alexander - Substack - 12th March 2023 "post-COVID memory impairment in humans is related to SARS-Cov-2 spike protein-specific immune reaction; do you understand the neurological implications of this study? what the mRNA shot does." Douglas Brodie to Sunak and Sturgeon: Why were there zero COVID deaths among doctors and nurses in Scotland? AND... - The Expose - 11th March 2023
Douglas Brodie has written an open letter to Installed Prime Minister Rishi Sunak and former First Minister of Scotland Nicola Sturgeon. As usual, he covers a lot of ground: covid, climate change, Agenda 2030 and The Great Reset, the Ukraine War, online censorship and “safety,” 15-minute cities and much more. Claims the unvaccinated were at higher risk of hospitalisation and death were based on deliberately murky record keeping - Norman Fenton - Substack - 7th March 2023
By late 2021 it was already clear in the UK that the covid vaccines did not stop infection or transmission. And there were also already plenty of concerning safety signals. So, even though the “vaccine pass” was then required in the UK to participate in daily life, ‘vaccine hesitancy’ was on the increase. Follow up on DNA contamination of COVID-19 injectable products - Jessica Rose - Substack - 9th March 2023
"Take Home Message: The left-over expression vectors used to manufacture the mRNAs are at contamination levels 100-fold higher than originally proposed and imply trillions of DNA molecules per dose. This has implications for integration into our genome." "Creepy Conspiratorial Globalists" Were Behind Covid Lockdowns, UK Pandemic Files Show - Igor Chudov - Substack - 5th March 2023
UK government officials wanted lockdowns cancelled, but were pressured to continue The UK government was reluctant to press on with lockdowns but was always pushed into lockdowns by powerful outside forces. Report 58: Part 2 - "Autopsies Reveal Medical Atrocities of Genetic therapies Being Used Against a Respiratory Virus" - DailyClout - 3rd March 2023
Findings: I. General Lesions affecting more than one organ were characterized by: Presence of Spike protein and absence of nucleocapsid protein (SARS-CoV-2 only). Both arterial and venous systems had inflammation of the inner lining of the blood vessel wall. Larger vessels had evidence of inflammation in the elastic fibers of the aorta and larger vessels. How are they ever going to explain the excess mortality data in Australia? - DailyClout - Steve Kirsch - 3rd March 2023
Australia didn’t have a lot of COVID deaths until after they rolled out the COVID vaccines. Now excess deaths are out of control. Something is causing those deaths. Any guesses?? Prepared Testimony - Pandemic Response - Robert W. Malone MD, MS - Substack - 1st March 2023
"During the SARS-CoV-2/COVID-19 outbreak, new policies and practices have been implemented which have circumvented or eliminated well-established pharmaceutical, regulatory and clinical development norms including established FDA, EMA, and ICH (International Council for Harmonisation) guidance. Furthermore, there has been an intentional and systematic failure to comply with established bioethical norms, including the 1947 Nuremberg Code, Geneva Convention, the 1964 Declaration of Helsinki, the US Belmont Report, and the US “Common Rule”." Reaffirming a Positive Correlation Between Number of Vaccine Doses and Infant Mortality Rates: A Response to Critics - Cureus - 2nd February 2023
Conclusions "There is a positive correlation between infant vaccines and infant mortality rates. This relationship is most pronounced in analyses of the most highly developed homogenous nations but is attenuated in background noise in analyses of nations with heterogeneous socioeconomic variables. Health authorities in all nations have an obligation to determine whether their immunization schedules are achieving desired goals. More investigations into the health outcomes of vaccinated vs. unvaccinated populations and the effect of vaccinations on all-cause mortality are imperative." Stroke Consultations Shoot Up by 25% Since Vaccine Rollout - The DailySceptic - 28th February 2023
Last month the U.S. CDC and FDA released a joint statement stating that they had identified a statistical signal of increased strokes after vaccination with Pfizer’s bivalent Covid booster vaccine in those aged 65 and over. How the public was captured by the military-industrial complex during the covid era - The Expose - 27th February 2023
Robert F. Kennedy Jr. speaks the truth about the authoritarian pandemic response that continues to threaten democracy and liberty as we know it. In an interview with journalist Kim Iversen, Kennedy explains how the military-industrial complex uses mind control techniques and fear to exert control over the population. Fear is the enemy, as it allows totalitarian systems to take control of people, destroying democracy in the process. Game Over: Medicare data shows the COVID vaccines increase your chance of dying - DailyClout - Steve Kirsch - 26th February 2023
This is why the CDC has NEVER used the Medicare data to prove the vaccines are safe. And this is why NOBODY in mainstream medicine wants you to see this data. EVER. They ALL want it hidden. FOREVER. Midazolam murders - were the elderly in Long Term Care homes killed with euthanasia drugs and labelled as COVID-19 deaths? - Dr. William Makis - 24th February 2023
The official narrative is that the elderly in Long Term Care homes were at high risk for COVID-19 infection and death. In 2020, most COVID-19 deaths occurred in Long Term Care homes. Protection From New COVID-19 Vaccines Drops Sharply Within Months: CDC - Epoch Health - 24th February 2023
A bivalent Pfize or Moderna booster increased protection against hospitalization initially by 52 percent, but that protection dropped to 36 percent beyond 59 days, U.S. Centers for Disease Control and Prevention (CDC) researchers said. Vaccine-Related Injuries May Be Related to Truncated mRNA (Part 2) - Epoch Times - 21st February 2023
The European Medicines Agency (EMA) has raised significant concerns about the impurity of truncated mRNA found in Pfizer's COVID-19 vaccine samples. Truncated mRNA molecules are a dire issue because changes to the specific protein-coding sequence could result in unexpected proteins and consequences in human cells. ONS Data: 25% Excess Mortality Among the Boosted is Obscured by Undercounting of the Unvaccinated - Igor Chudov - Substack - 21st February 2023
Oops, the unvaxed were 50% undercounted. Today, on Feb 21, 2023, UK’s ONS released the much-awaited “Deaths by Vaccination Status” data set. The report is expansive, shows COVID-19 and overall mortality, and conveniently breaks it up by age, sex, or both—a very valuable and interesting resource. mRNA Vaccines are "Vaccines" - Aaron Siri - Substack - 19th February 2023
"Like it or not, mRNA vaccines are no less a vaccine than other vaccines" "These messages, no doubt, arise from a desire to hold onto dogmatic beliefs about vaccines in general by claiming that mRNA Covid-19 vaccines are not “vaccines.” That “real” vaccines are different. Better. The reality, however, is that these vaccines are as much “vaccines” as any other vaccine." Why Read "Turtles All the Way Down"? - Robert W Malone MD,MS - Substack - 17th February 2023
Essential reading for parents and all who want to understand vaccine safety "science" "Having lived through the shifting narratives concerning the safety and effectiveness of various gene therapy-based SARS-CoV-2 (COVID) vaccines, many parents have begun to question the entire childhood vaccine enterprise." mRNA technology: Lessons and consequences - Rumble - Jessica Rose - 16th February 2023
Dr Jessica Rose - PANDEMIC STRATEGIES, LESSONS AND CONSEQUENCES, 21st- 22nd January 2023 The First Mandatory Vaccination Campaign That Crippled America's Pilots - Robert W Malone MD, MS - Substack - 16th February 2023
The forgotten history of the military's disastrous anthrax vaccination campaign. One of the most troubling consequences of the COVID-19 vaccines are the implications for airline safety-- there have been numerous harrowing cases recently involving airline pilots having heart attacks or dying, which, almost resulted in a catastrophe . The Federal Government is Tracking the Unvaccinated - Epoch Times - 14th February 2023
The U.S. government has been secretly tracking those who didn’t get the COVID jab, as well as those who aren’t up to date on their shots. Worse, it is recording the reason why. Now that the program has been widely adopted, know why it’s being done and how you can outsmart it. Flu Vaccines: What's the Fuss? - Epoch Health - 14th February 2023The government’s belief in the importance of a yearly flu vaccine is so strong that it has reached the pitch of religious fervor.
“I really believe this is why God gave us two arms,” White House COVID response coordinator Dr. Ashish Jha said at a September 2022 news briefing, right at the beginning of the flu season: “one for the flu shot and the other for the COVID shot.” Why Does the U.S. Have a Secret Confidentiality Agreement with the UK to Hide Vaccine Safety Issues? - Megan Redshaw - Substack - 13th February 2023
New documents obtained by Judicial Watch show U.S. regulatory agencies have a 'mutual confidentiality agreement' with the equivalent of the UK's FDA to hide information on COVID vaccine injuries. Devastating Australian NSW data showing the quadrupled COVID mRNA vaccinated (4 shots) have massive spikes in hospitalization & death!
Data as of December 2022 and NOTE: dose response & no vaxx - Dr. Paul Alexander - Subatck - 12th February 2023 Keep in mind that wherever there has been elevated COVID vaccine rates, there are elevated excess infections and deaths. Period! The data is stable. And I refer to the mRNA platform especially yet were have serious problems with the mRNA as well as DNA platform. Denis Rancourt (and team's) new report on vaccine dose fatality rate (vDFR) - in a nutshell - Jessica rose - Substack - 13th February 2023
"The doubling times in this case are calculated based on age, so basically the risk of dying doubles every 5 years, per injection, and therefore, it is precisely the elderly who should NOT have gotten these shots first, if at all." UKHSA: Boosters Greatly INCREASE Covid Severity 6-9 Months after Vaccination - Igor Chudov - Substack - 11th February 2023
SUMMARY: UKHSA’s report shows that instead of “protecting” people from Covid-19, Covid vaccines significantly increase the risk of hospitalization in months 7-9 after vaccination. CDC Now Recommends Children and Adults with Heart Disease Get Doses of Covid Vaccine - Aaron Siri - Substack - 10th February 2023
Pushing injections of a product that causes heart inflammation on those with heart disease is heartless. CDC just published its childhood and adult vaccine schedules for 2023. Once again, CDC has proven itself a mindless cheerleader of Covid-19 vaccines. For CDC, the answer to nearly every question is “more shots!” A Primer on Medical Gaslighting - A Midwestern doctor - Substack - 9th February 2023
How the institution of medicine covers up the inevitable harms of its unsafe therapeutic toolbox. One of the classic ways an abuser controls their prey is to manipulate the environment so that the abused individual begins doubting their own observations regardless of what is occurring in front of them. Messenger RNA Sequences Found in Blood 28 Days After COVID-19 Vaccination - Epoch Health - 9th February 2023Messenger RNA sequences from the Pfizer and Moderna COVID-19 vaccines were found in the blood of multiple individuals weeks after vaccination, according to a new study.
Researchers in Denmark analyzed samples from the vaccinated and detected partial or even full sequences of the messenger RNA (mRNA) following vaccination. The sequences were found as late as 28 days after vaccination, or the longest time period the study analyzed. V-Safe Part 6: A First Look at What the V-Safe Check-the-Box Data Reveals! - Aaron Siri - Substack - 8th February - 2023Sixth part of an incredible story that shows just how broken our public “health” apparatus is: very, very broken.
Dr Fauci Knew Covid Vaccines Would Never Give Us Herd Immunity - Igor Chudov - Substack - 6th February 2023
A new scientific study is out, and Anthony Fauci co-authored it. What is remarkable about that study is the derogatory language Fauci et al. employ towards influenza and Covid vaccines. They Lied to Us About Myocarditis, too - Igor Chudov - Substack - 4th February 2023
Science and our health authorities told us that “myocarditis is much more frequent from Covid than from vaccination.” Watch Dan Cohen's Shocking Investigations into Fauci Underling Peter Hotez - Uncaptured - Substack - 26th January 2023For Redacted, Dan Cohen examines how Peter Hotez came to prominence thanks to Fauci, Bill Gates and the Clintons, and how he has served as a deceptive political creature throughout the COVID era.
Episode 305: Gain of Dysfunction - The Highwire - 2nd February 2023Del Breaks Through With Dr. Drew; VRBPAC Committee Reveals FDA Lacks Data To Back “Flu-Shot” Fast-track COVID Vaccine Push; Ex-Eco Health Alliance Executive Exposes the Truth About Wuhan; Project Veritas, the Pfizer Whistleblower, and Directed Evolution?; Tennis Star Novak Djokovic A Champion for All in Australia, Named HighWire Hero of The Year
Guest: Andrew G. Huff, PhD Third Dr. J. T. Walker/Pfizer- Project Veritas Video - Robert W Malone - Substack - 3rd February 2023
"With today’s disclosure from the undercover investigations, we now learn more about current vaccine reproductive risk findings, Pfizer’s lack of comprehension of the basis for those risks, and (according to Dr. Walker) Pfizer’s leading hypothesis concerning the patho-physiologic basis for those risks. Once again, the implications are stunning and broad ranging," Guillain-Barre Syndrome Linked to COVID-19 Vaccine: CDC Study - Epoch Health - 3rd February 2023
Seventy-three cases of Guillain-Barré Syndrome, which causes the immune system to attack parts of the nervous system, were confirmed in adults within 42 days of vaccination with Johnson & Johnson’s shot, the U.S. Centers for Disease Control and Prevention (CDC) reported in the Feb. 1 paper. Inside the Secret Government Meeting on COVID-19 Natural Immunity - Epoch Health - 2nd February 2023
Four of the highest ranking U.S. health officials—including Dr. Anthony Fauci—met in secret to discuss whether or not naturally immune people should be exempt from getting COVID-19 vaccines, The Epoch Times can reveal. The officials brought in four outside experts to discuss whether the protection gained after recovering from COVID-19—known as Natural immunity—should count as one or more vaccine doses. Immune Exhaustion Emerges After 3rd Vaccine Dose: Current Findings - Epoch Health - 30th January 2023
Vaccines have been upheld as the best strategy for dealing with infectious diseases, but that’s largely because of a limited understanding of the immune system and how to best complement and support its function. Our bodies are normally able to separate the wheat from the chaff when it comes to invading pathogens or when a vaccine stimulates an immune reaction, but there are factors that can compromise that. Recent Data Shows 'Stunning Increase' in Serious Harm Reports in Young Healthy Pilots: Army Lt. Col. Theresa Long - Epoch Health - 31st January 2023
It’s been a year since four Department of Defense (DOD) whistleblowers found a sudden increase in various diseases in the Defense Medical Epidemiology Database (DMED), which coincided directly with the introduction of COVID-19 vaccinations. Now, new data shows more evidence. It's Time for the Scientific Community to Admit We Were Wrong About COVID and It Cost Lives | Opinion - Newsweek - 30th January 2023
As a medical student and researcher, I staunchly supported the efforts of the public health authorities when it came to COVID-19. I believed that the authorities responded to the largest public health crisis of our lives with compassion, diligence, and scientific expertise. I was with them when they called for lockdowns, vaccines, and boosters. I was wrong. We in the scientific community were wrong. And it cost lives. Esteemed Cardiologist: 'Stop This Rollout Now' - Epoch Health - 26th January 2023
Britain’s most influential cardiologist, who took two jabs, now calls for a halt in the rollout of the shot program after spending nine months evaluating the data. He offers a potential explanation for the differing world views. UK Govt Tacitly Admits MRNA Experiment Has Failed. Media Silent - Principia Scientific - 27th January 2023
In case you missed it, yesterday, the UK government (through its agencies) made a major announcement on the availability of the COVID “vaccine” (albeit a decision made in Nov last year that they’ve sat on for almost 3 months for some reason) In summary, the Joint Committee on Vaccination and Immunisation (JCVI) advises that healthy people, aged under 50 should no longer be “offered” (whatever that term really means) the COVID “vaccine”. JUST IN: CDC Deputy Director - Tom Shimabukuro Admits COVID Vaccines are Causing "Debilitating Illnesses" -Rumble - The Vigilant Fox - 27th January 2023
"We are aware of these reports of people experiencing long-lasting health problems following COVID vaccination" Episode 304: NEVER AGAIN - The Highwire - 26th January 2023
Persecution of the Vaccine-Injured Proliferates on TikTok, Twitter, after Angelia Deselle Tweet Goes Viral; Australian Doctors Liability Law Backfires Big; Drugs and Surgery For Childhood Obesity? FDA Says Yes; Introducing a New HighWire News & Editorial Contributor!; Remembering the Lessons of the Holocaust, with a grave warning from one of its Survivors; Is the WEF Losing its Luster? Guests: Angelia Deselle, Tracy Beanz, Vera Sharav Another COVID-19 "Conspiracy Theory" Comes True! - A Midwestern Doctor - 25th January 2023
Yearly ineffective and unsafe COVID-19 vaccines epitomize the pharmaceutical business model. New diagnosis codes for COVID-19 immunization status - Robert W Malone MD, MS - Substack - 25th January 2023
Just what does ICD code Z28.310: Unvaccinated for COVID-19 mean? Speaking for the Dead - Robert W Malone MD, MS - Substack -15th January 2023
"The vaccine damaged are literally and repeatedly told by physicians, society, and their own families that they are mentally ill. As if the original damage and lack of any practical recourse or road to recovery was not bad enough, society has determined that they must be ostracized and cast into a pit of eternal self doubt and recrimination." Doxycycline for the prevention of COVID-19 to severe disease requiring intensive care unit (ICU) admission: A randomized, controlled, open-label, parallel group trial (DOXPREVENT.ICU) - PlosOne - 23rd January 2023
Conclusions In hospitalized COVID-19 patients, doxycycline, a safe, inexpensive, and widely available antibiotic with anti-inflammatory properties, reduces the need for ICU admission when added to SoC. Protective Effect of Vitamin D Supplementation on COVID-19-Related Intensive Care Hospitalization and Mortality: Definitive Evidence from Meta-Analysis and Trial Sequential Analysis - MDPI - 16th January 2023
"Vitamin D administration results in a decreased risk of death and ICU admission (standardized mean difference (95% CI): 0.49 (0.34–0.72) and 0.28 (0.20–0.39), respectively). The TSA of the protective role of vitamin D and ICU admission showed that, since the pooling of the studies reached a definite sample size, the positive association is conclusive." Mainstream News Is Finally Admitting The Experts Don't Agree On COVID Jab - Rumble - Bannons War Room - 23rd January 2023
Mainstream News Is Finally Admitting The Experts Don’t Agree On COVID Jab After Daily Clout Exposed Ignored Data, Dr. Wolf Reports MHRA admits 74% of vaccine injuries are 'serious' - yet still insists jabs are safe - The Conservative Women - 23rd January 2023
Jenny Brown, an independent healthcare professional with significant nursing experience, has examined and analysed each of the approximately 75 MHRA Yellow Card Covid vaccine reports (adverse events data) published since the beginning of the Covid ‘vaccine’ roll-out. It is her analyses which have informed TCW‘s MHRA Yellow Card reporting to date. We are grateful for her efforts in transforming complexity into clinically relevant and accessible information. CDC Aware of Hundreds of Safety Signals for COVID Jab - Mercola Articles - 23rd January 2023
In September 2022, The Epoch Times asked the U.S. Centers for Disease Control and Prevention to release its Proportional Reporting Ratio (PRR) data mining results. The CDC refused. A Freedom of Information Act (FOIA) request has now forced the release of these data, and they are stunning Africa Is Starkly Unvaccinated, and Starklly Unvanquished by COVID - Epoch Health - 20th January 2023
"Lets study that victory with utmost diligence". "One who has faith in the practice of vaccination would have also expected that vaccines carrying the name of the pandemic to have mitigated case counts of the same disease. How then is the overall experience of the African continent to be understood?" Identification of druggable host dependency factors shared by multiple SARS-CoV-2 variants of concern - BioRxiv - 9th January 2023
"All drugs were highly effective against all tested variants, including delta and omicron, new variants that emerged during the study. Mechanistically, we identified ROS production as a pivotal step in early virus propagation. Antioxidant drugs, such as N-acetyl cysteine (NAC), were effective against all variants both in human lung cells, and in a humanised mouse model. Our study strongly supports the immediate use of available antioxidant drugs, such as NAC, as a general and effective anti-COVID-19 approach." UK Statistics Regulator agrees with our recommendation to ignore any claims of vaccine safety based on ONS deaths by vaccination status data - Norman Fenton and Martin Neil - Substack - 20th January 2023
On 11 November 2022 we wrote a formal letter of complaint to the Statistics Regulator about the Office for National Statistics (ONS) data on vaccine mortality. We said it was not fit for purpose: Cardiac Arrest and Death after COVID-19 Vaccination - Peter A. McCullough, MD, MPH - 20th January 2023
Virtually every day in the news we hear about a young person, perfectly healthy, with no antecedent illness drop dead without explanation. As the cases roll in it has been my general observation that if the cardiac arrest is witnessed and there is prompt defibrillation, as in the case with Demar Hamlin, then neurologic and overall survival is possible. More Evidence of mRNA vaccine failure - HART - 18th January 2023
Concerning news about both safety and efficacy of the mRNA products seems to emerge every day and it is impossible to cover everything, so for this article we have selected just 2 notable new pieces of evidence. Just before Christmas, a new vaccine efficacy study was published with (for the proponents of the mRNA products) some surprising and inexplicable results. Two Minutes Love - DailyClout - 19th January 2023
Readers might be familiar with the "Two Minutes Hate" It’s an idea from George Orwell’s novel 1984, a two-minute ritual in Orwell’s fictitious society, Oceania. The ritual involved the mandated viewing of programs projected onto large telescreens, with no religious or medical exemptions. The FAA has very quietly tacitly admitted that the EKGs of pilots are no longer normal. We Should be concerned. Very concerned. - Steve Kirsch - Substack - 17th January 2023
After the vaccine rolled out, the FAA secretly widened the EKG parameter range for pilots so they wouldn't be grounded. It looks like the vax gave at least 50M Americans heart damage. Fauci Knew Boosters Could Cause Immune Tolerance; Pushed for them Anyway - Igor Chudov - Substack - 15th January 2023
SUMMARY: This post presents evidence proving that Tony Fauci and immunologists knew that mRNA Covid boosters could cause disease-enabling immune tolerance. Despite that documented knowledge, they inexplicably pushed to boost people repeatedly, ruining their immunity to Sars-Cov-2. The Great Reset: The 52 Heads of State and Hundreds of Government Officials collaborating with the WEF at Davos 2023 - The Expose - 12th January 2023
This year’s World Economic Forum’s (“WEF”) annual meeting at Davos is being held from 10 to 16 January. As the Globalists meet, organisers have confirmed the WEF will host 52 heads of state and government and nearly 600 CEOs. Additionally, nearly 300 government ministers are expected to take part. Immune Tolerance: IgG4 Class Switch Starts with Even Two Doses of mRNA Vaccines - Ivor Chudov - Substack - 12th January 2023
"Another piece of bad news/good news came out yesterday. A study analyzing antibody classes in vaccinated people was just published. It has many findings and is worth several separate posts." "The main finding and the bad news is that mRNA vaccines induce immune tolerance, evidenced by IgG4 antibodies, even after two doses (initial “fully vaccinated” series)." A short note on cognitive dissonance - How this ends - slowly, one by one - Joel Smalley - Substack - 14th January 2023
What I focused on (at least 18 months ago) was the fact that no amount of gaslighting, discrediting and propaganda could change the facts that presented themselves in the face of people - when a friend of a friend (i.e. two degrees of separation) is vaccine-injured, they know about it. And the bush telegraph chimes louder than The Daily one. I said that when that time came, it would all be over. Well, that time probably came some time ago so I had to caveat my prediction with the random variable of cognitive dissonance. COVID-19 IMM Update - The Institute for Molecular Medicine - November 2020
COVID-19 Coronavirus: Is Infection Along with Mycoplasma or other Bacteria Linked to Progression to a Lethal Outcome? by Garth L.Nicolson Phd, MD (H) and Gonzalo Ferreira de Mattos, MD, PhD. another look at UK all cause mortality by vaxx status - el gato malo - 11th January 2023
"using just ONS ASMR per person-year data from their own calculations, we can still show that vaccination is associated with alarmingly higher all cause death rates by may 2022 this becomes more pronounced when we add in the 21 day post jab period excluded from most analyses as that period shows greatly elevated risk of death vs both unvaxxed and that same vaxxed cohort at 21 days+" Why Is The Vaccine Killing Our Young Men and Women? - A Midwestern Doctor - 7th January 2023
"Presently, I believe the most probable culprit for the vaccine injuries is the spike proteins they produce. Almost all of the vaccine side effects I’ve observed have a mechanism that can be linked to a consequence of the spike protein, and the spike protein is the only common factor present in the following (all of which have overlapping symptoms)": Did National Security Imperatives Compromise COVID-19 Vaccine Safety? - Brownstone Institute - 5th January 2023
"The US Department of Defense (US DoD) has had a dominant role in the response to the SARS-CoV-2 virus and in the development, and distribution of the Covid 19 vaccines, a fact hidden from the general public. In those processes many standard steps and procedures, otherwise required for pharmaceutical products, were omitted or circumvented." Amazing admission from the GodMother of Vaccines - All the trials the CDC rely on to push the childhood vaccine agenda - were never designed to investigate if they caused Autism.
The Highwire - 6th January 2023 Informed Consent Action Network (icandecide.org) funded Lead Attorney, Aaron Siri, Esq., to depose and later cross-examine world-leading Vaccinologist, Dr. Kathyrn Edwards in 2020. Within the hours-long cross-examination she gave a shocking answer to the question; “Do childhood vaccine trials support the CDC’s claim that vaccines do not cause autism?” Regardless of your stance on the issue of Vaccines and Autism, her answer is a must-see. CDC Finally Released its VAERS Safety Monitoring Analyses for COVID Vaccines via FOIA - DailyClout - 5th January 2023
CDC’s VAERS safety signal analysis based on reports from Dec. 14, 2020 – July 29, 2022 for mRNA COVID-19 vaccines shows clear safety signals for death and a range of highly concerning thrombo-embolic, cardiac, neurological, hemorrhagic, hematological, immune-system and menstrual adverse events (AEs) among U.S. adults. Circulating Spike Protein Detected in Post-COVID-19 mRNA Vaccine Myocarditis - Circulation - 4th January 2023
CONCLUSIONS: Immunoprofiling of vaccinated adolescents and young adults revealed that the mRNA vaccine–induced immune responses did not differ between individuals who developed myocarditis and individuals who did not. However, free spike antigen was detected in the blood of adolescents and young adults who developed post-mRNA vaccine myocarditis, advancing insight into its potential underlying cause. 'Pre-bunking' lies around biotech, the serial killer - The Conservative Woman - 5th January 2023
JEREMY Fleming, the head of GCHQ (Government Communications Headquarters), one of three leading spy agencies in the UK, has publicly discussed the agency’s wish to promote ‘pre-bunking’ – feeding the public with information designed to undermine narratives before they even appear on social media. In other words, spy agencies originally tasked with monitoring events are now engaged in spreading propaganda about things that haven’t actually happened, and probably have been doing so for a long time. The American Public is Extremely Worried About the Vaccines - A Midwestern
Doctor - Substack - 3rd January 2023 For most of my lifetime, I have watched people be seriously injured by pharmaceuticals and have their plight be ignored either because: The injuries were subtle enough they could not be recognized unless someone was trained to identify them (which most doctors are not). In turn, one of the great difficulties I’ve had throughout my career is continually observing medical injuries that are rarely identified by my colleagues (and which often are necessary to treat in order to alleviate the patient’s current issue). EXCLUSIVE: CDC Finds Hundreds of Safety Signals for Pfizer and Moderna COVID-19 Vaccines - Epoch Health - 3rd January 2023
The Centers for Disease Control and Prevention (CDC) has identified hundreds of safety signals for the two most widely administered COVID-19 vaccines, according to monitoring results obtained by The Epoch Times. Bell’s palsy, blood clotting, and death were among the signals flagged through analysis of adverse event reports submitted to the Vaccine Adverse Event Reporting System (VAERS). The CDC, which runs VAERS with the Food and Drug Administration (FDA), describes it as “the nation’s early warning system” for vaccine issues. Shocking Lab Investigation of COVID Vaccines - Epoch Health - 1st January 2023
A recent laboratory investigation by The Highwire reveals the only consistent thing about the COVID shots are their inconsistency. There is no quality control. Some appear clear like saline, while others are loaded with contaminants In August 2021, Japan rejected 1.63 million doses of Moderna’s mRNA shot due to contamination. Last year the European Medicines Agency (EMA) also expressed concern over vials that were only 50% to 55% pure. Let's Emancipate Ourselves From Mental Slavery In 2023 - Dr Tess Lawrie - Substack - 1st January 2023
In 2023, I have resolved to be especially curious and open minded and I’m trusting you may wish to join me! Where signposts say “Go this way” we’ll be exploring the other way, where television presenters say “Look over here” we’ll be looking over there, and where people have been labelled “conspiracy theorists” we will be hearing them out with an open mind. This desire to investigate the contrary is not for the sake of being contrarian but stems from the profound realisation over the past three years that all is not as it seems. Fact is, if we have been fed a pack of lies about a deadly pandemic, what other lies have we been sold? Do Vaccines Cause Autism? - Megan Redshaw - Substack - 30th December 2022
I can't believe Steve Kirsch just publicly admitted he thinks vaccines cause autism. We've waited a long time for this. Criminal Malfeasance: Pfizer Knew 275 People Suffered Serious Strokes in the First 90 Days After Vaccine Rollout - DailyClout - 29th December 2022
Seventy-five years. That’s how long Pfizer and the FDA tried to hide the Pfizer documents from public view — long after just about everyone affected is dead. It wasn’t until renowned attorney Aaron Siri led a FOIA case against the FDA that a federal judge ordered the documents to be released in 108 days, the same amount of time it took the FDA to approve the Covid-19 injections. IgG4 and cancer - a mechanism of action for cancer relapse and onset - Jessica Rose - Substack - 30th December 2022
As you all know, IgG4 has come onto the hot-seat lately in the context of the mRNA shots. I was prompted this morning after watching Chris Martenson’s summary video of Jikkyleaks’ new FOI findings to look into the relationship between IgG4 and cancer. Again, cancer statistics in VAERS and from clinical settings are completely atypical since the roll-out of the COVID shots and I have been sounding the alarm on this for over a year. How COVID Vaccines Cause Cancer - Epoch Health - 30th December 2022
Antibodies are studied more than other immune proteins for association with disease. This does not mean that they are more decisive in disease outcomes. Type I interferon likely has far more impact. Twitter Is Exploding With Live COVID-19 Discussions (Here Are Two Examples) - Rumble - Sunfellow - 29th December 2022
Now that many of the most highly-censored doctors, scientists, researchers, and citizen journalists have been reinstated on Twitter, Twitter is exploding with real-time conversations. This video contains excerpts from two recent live Twitter Spaces discussions. "I was seeing a lot of this stuff myself, really some extraordinary stuff. When you say debilitating . . . life altering kinds of reactions in people." "In our department we had two doctors and a nurse go down within a two week period and I've never seen anything like this in my life." "I'm not an anti-vaxxer but I know this vaccine killed my son and I am living the worst nightmare that anyone could even imagine." The immunological mechanism of action for lost immunity, a shift to tolerance an autoimmunity from the shots - Jessica Rose - Substack - 27th December 2022If you want some proof to show pro-COVID shot nay-sayers that these shots are detrimental to normal functioning immune responses, read them this. Before I get into this paper that should stop the presses and provide a one-way ticket for a lot of people to prison for the rest of their lives (as a best punishment), I refer to an earlier article that I wrote on immunological tolerance. I wrote this piece on July 10th, 2022, and now this group, who I may add have NO CONFLICTS OF INTEREST, have confirmed a mechanism of action of spike tolerance and so yes, the spike protein might be capable of destroying tolerance itself.
Philadelphia 2023 - Your Immune system on the Edge - Arkmedic's blog - Substack - 27th December 2022
Two papers have appeared in quick succession that just need to be put together and I need to tell you what they mean in the context of a more familiar paper. And it’s a real problem. To be honest I wasn’t paying that much attention until my favourite anonymous proteomics scientist sent this message in a telegram group (btw thanks Pavel Durov, you gave us a home when twitter sent us into exile). It was about IgG4. I challenge anyone to put this better and, in inimitable Ersa-style, in so few words. Growing Number of Neurological Complications After COVID-19 Vaccination - Epoch Health - 26th December 2022
Before the COVID-19 era, for ages in medicine it has been said: “Syphilis is often referred to as “the great masquerader,” as it may present with a wide array of clinical symptoms and may mimic a variety of other diseases making diagnosis challenging.” There is no doubt that COVID-19 vaccine injury syndromes will far eclipse syphilis, sarcoidosis, amyloidosis, or any other systemic disorder and will assume the throne of “the great masquerader”. An Ode to the Brave: The World Depends on You - Epoch Times - Tessa-Lena - 23rd December 2022
STORY AT-A-GLANCE We are living under a mob, once we get it, everything makes sense. Mobsters in charge have big loads of money and big loads of tricks; but their power greatly depends on our willingness to be afraid or confused. On the existential level, what we are up against is “unlove,” the hatred of free-roaming life. We have all the power to choose what’s right, to pray from our hearts, and to protect each other from the mob. A new development in the FOREIGN DATA PURGE missing myocarditis signal story - Jessica Rose - Substack - 23rd December 2022
"The difference in the myocarditis signal is striking when you compare pre- (Nov 11, 2022) and post (Dec 12, 2022)-data purge. Both the magnitude and the dose 3 response of the myocarditis signal was affected, in extreme ways. In fact, the dose 3 response completely disappeared! Poof! That happened on November the 18th, 2022. Here’s the evidence." Missing VAERS Reports: Dr. Rochelle Walensky and the CDC Are Covering Up the Scene of a Crime - Rumble - The Vigilant Fox - 21st December 2022
"Dr. Ealy has confirmed, and Jessica Rose also confirms independently, that CDC, meaning Dr. Walensky, has removed 32,000+ records of myocarditis and pericarditis from the VAERS database between September of 2022 and December of 2022," reported Dr. Naomi Wolf. New COVID-19 Boosters Just 30% Effective, Study Finds - Epoch Health - 21st December 2022
The new COVID-19 vaccine boosters barely provide any protection against infection, according to a new study. The boosters, from Pfizer and Moderna, were just 30 percent effective in preventing infection, researchers with the Cleveland Clinic found. REUTERS: 'COVID pandemic led to surge in superbug infections, EU agency says' - we argue NO & I agree with Vanden Bossche who has been prescient all along in warning the world on the COVID vax harms - Paul Alexander - Substack - 21st December 2022
It is merely due to the fact that all attention of antigen-presenting cells (APCs) in highly vaccinated populations is now focused on stimulating tons of MHC-unrestricted cytolytic T cells (CTLs) Pfizer's COVID-19 Vaccine Linked to Blood Clotting: FDA - The Epoch Times - 17th December 2022Pfizer’s COVID-19 vaccine has been linked to blodd clotting in older individuals, according to the U.S. Food and Drug Administration (FDA).FDA researchers, crunching data from a database of elderly persons in the United States, found that pulmonary embolism—blood clotting that forms in the body and winds up blocking blood flow in the lungs—met the initial threshold for a statistical signal and continued meeting the criteria after a more in-depth evaluation.
The "Tripledemic of 2022" is Already Ending. Pfizer is Using it to Push its New RSV Vaccine for Pregnant Women - Igor Chudov - Substack - 17th December 2022
The “tripledemic” of 2022, with flu, Covid, and RSV going simultaneously, is all over the news. Everyone, including myself and other substackers, is incentivized to play it up and catastrophize it. Alarming antibody evasion properties of rising SARS-CoV-2 BQ and XBB subvariants - Cell - 13th December 2022
BQ.1, BQ.1.1, XBB, and XBB.1 are the most resistant SARS-CoV-2 variants to date Serum neutralization was markedly reduced, including with the bivalent booster All clinical monoclonal antibodies were rendered inactive against these variants The ACE2 affinity of these variants were similar to their parental strains COVID Vaccines Do Not Prevent Hospitalizations in the UK - Igor Chudov - Substack - 16th December 2022
This is a brief post based on the latest UKHSA vaccine effectiveness report. Do Covid vaccines help vaccinated people avoid hospitalization? Two tables from two UKHSA reports shed light on this question — and the answer is — the Covid vaccines are NOT OF ANY HELP in preventing hospitalizations. Cardiovascular Issues via Molecular Mimicry May Be What's to Blame for the Rise in Sudden Death - Rumble - The Vigilant Fox - 15th December 2022
"This one [paper] looked particularly at five patients who died unexpectedly within seven days of their COVID vaccine. And they propose that molecular mimicry is what's causing this," informed Dr. Stephanie Seneff. "It's basically the spike protein produces these sky-high levels of these IgG antibodies. And then those antibodies start attacking your own tissues through this mechanism of molecular mimicry, meaning that the sequence in the spike protein that the antibody matches resembles a sequence in the other protein, that's a human protein, that will attack it. A human protein in the heart to cause heart damage." mRNA Behind the Reoccurrence of COVID-19 Symptoms in Fully Vaccinated Individuals? - Epoch Health - Dr. Peter A McCullough - 13th December 2022
One of the curious findings from the original randomized trials of mRNA vaccines was an explosive rate of early infection after the first injection as compared with placebo. In a recent paper from Sfera et al, the description of pathological syncytia or fusion between immune cells is described: “The LNP technology, to put it simply, mimics viral envelopes with externalized phosphatidylserine (ePS), a universal “eat me” signal, that directs immune cells to engulf the particle. Antibody feedback regulates immune memory after SARS-CoV-2 mRNA vaccination - Nature - 6th December 2022
"Our results indicate that pre-existing high-affinity antibodies bias GC and memory B cell selection by two distinct mechanisms: (1) by lowering the activation threshold for B cells thereby permitting abundant lower-affinity clones to participate in the immune response, and (2) through direct masking of their cognate epitopes. This may in part explain the shifting target profile of memory antibodies elicited by booster vaccinations." What are these vaccines doing to the nation's children and where is the benefit? - Hart Group - 11th December 2022
This week over one hundred health professionals wrote to the MHRA regarding Moderna’s application for a conditional marketing authorisation for Spikevax for babies from 6 months upwards. This baby dose has already been approved in the US and added to their routine immunisation schedule, thus removing any distinction between a novel technology gene-based vaccine rushed to market under the pretext of an ‘EMERGENCY’ and standard vaccines. Maintaining this distinction is vitally important, as there are still major unanswered questions about the long-term safety of mRNA products, which HART has discussed recently. FDA Approves Bivalent Vaccine for Babies in TWO DAYS - Igor Chudov - Substack - 8th December 2022
Pfizer Can Get Anything Approved "At the Speed of Science" The warp-speed approvals of anything that Pfizer asks the FDA to approve continue. On December 5, Pfizer asked the FDA to allow bivalent shots for babies six months and up. Today, on December 8, the application was approved. Do We All Agree that the COVID-19 mRNA Injections are Bioweapons Now? - The Kingston Report - 5th December 2022
When is the right time to inform the American people that they have been subjected to psychological and biological warfare by their own government under the guise of public health and safety? Unsafe and Unsanitary Practices exposed at Merck's Vaccine Manufacturing Facility - ICAN - 9th December 2022"
In response, the FDA recently produced a 95-page "Establishment Investigation Report" which detailed a 2017 inspection at Merck’s West Point, Pennsylvania facility which manufactures Merck’s Hepatitis B vaccine (Recombivax HB) as well as Merck’s Pneumococcal, HPV, and MMR vaccines. The inspection uncovered a number of highly disturbing findings, including unsanitary practices, mislabeled vaccine products, unqualified workers, mold contamination, bacteria contamination, and failure to report or investigate production issues. Among the more shocking findings from the inspection were the following:" Study: Natural Immunity Is Best Against Omicron - Epoch Health - Rober W Malone - 8th December 2022
"It is hard to believe, but the CDC is actually recommending that everyone get a booster every two months. Why is that? Because the CDC wants everyone to think that this is how long people are “protected” after injection." UK Regulator Approves Pfizer's COVID-19 Vaccine for Babies and Young Children - Epoch Health - 6th December 2022
The UK’s medicines regulator on Tuesday gave the greenlight for the Pfizer/BioNTech COVID-19 vaccine, also known as Comirnaty, to be used on children in Britain aged between 6 months and 4 years old. Expert on Aluminum Toxicity Forced Out of University - Epoch Health - 25th November 2022
Christopher Exley is one of the most knowledgeable and widely cited aluminium researchers in the world. Exley has published over 200 peer-reviewed scientific papers and recently authored a book about aluminum, “Imagine You Are an Aluminum Atom: Discussions With Mr. Aluminum” (Skyhorse, 2020). Are Covid boosters causing cancer? - Dr. Tess Lawrie - Substack - 4th December 2022
Tess Talks with Professor Angus Dalgleish MD FRACP FRCP FRCPath FMedSci Professor Dalgleish is Professor of Oncology at St George’s University of London, a Fellow of the Royal College of Physicians of the UK and Australia, the Academy of Medical Sciences, and the Royal College of Pathologists. He is co-discoverer of the fact that HIV uses CD4 as a cell receptor in humans. As an oncologist, his main focus has been on developing immunotherapies to treat cancer. Autopsy-based histopathological characterization of myocarditis after anti-SARS-CoV-2 vaccination - SpringerLink - 27th November 2022
"Overall, autopsy findings indicated death due to acute arrhythmogenic cardiac failure. Thus, myocarditis can be a potentially lethal complication following mRNA-based anti-SARS-CoV-2 vaccination. Our findings may aid in adequately diagnosing unclear cases after vaccination and in establishing a timely diagnosis in vivo, thus, providing the framework for adequate monitoring and early treatment of severe clinical cases." The Genetic Mechanism by which the COVID mRNA Jabs cause the Intravascular Growths seen in the 'Died Suddenly' Documentary - The Expose - 29th November 2022
"What is causing the rubbery blood clots that so many embalmers are now finding in young and middle-aged people who died suddenly?" Submission: An Open Letter to the Silent Doctor - World Council For Health - David Penner - 30th September 2022
“The sad truth is that most evil is done by people who never make up their minds to be good or evil.” – Hannah Arendt, The Life of the Mind This is a letter to the silent doctor. This is a letter to every physician who senses that the ongoing biofascist putsch is scientifically, morally, and politically wrong, yet maintains a policy of willful ignorance so as to protect their careers. It is not too late to cast off your sordid shackles of inhuman blind obedience. Cast off these lies, these monstrous deceptions, and uphold that sacred oath without which a doctor is but a blackened husk and a soulless lifeless shell. Inability to work following COVID-19 vaccination among healthcare workers - an important aspect for future booster vaccinations - MedRxiv - 21st November 2022
"Both the absolute sick days and the rate of HCWs on sick leave significantly increased with each subsequent vaccination. Comparing BNT162b2mRNA and mRNA-1273 the difference in sick leave was not significant after the second dose, but mRNA-1273 induced a significantly longer and more frequent sick leave after the third. Interpretation A considerable number of HCWs have been on sick leave after COVID-19 vaccination, staff absences increase with each additional dose, depend on the vaccine, and vary between HCWs' gender, and profession. In the light of further COVID-19 infection waves and booster vaccinations, there is a risk of additional staff shortages due to post-vaccination inability to work, which could acutely overload healthcare systems and jeopardise patient care. These findings will aid further vaccination campaigns to minimise the impact of staff absences on the healthcare system." Is RSV More Severe in Covid Vaccinated Kids Due To Destroyed Hematopoietic Stem Cells? - Igor Chudov - Substack - 18th November 2022
"Desperate mothers whose kids are hospitalized report this on Twitter. They also complain that WHILE THEIR KIDS ARE BOOSTED, other parents refuse to vaccinate their children. The connection between “my 6-year-old got her Covid booster” and “my 6-year-old is in hospital with RSV” escapes their minds:" Potential Mechanisms for Human Genome Integration of Genetic Code from SARS-CoV-2 mRNA Vaccination - ResearchGate - November 2022
Background The findings of a sequence embedded in Human DNA that was almost identical to a sequence in the SARS-CoV-2 genome, and the identification of plausible integration of SARS-CoV-2 RNA into human DNA by endogenous reverse transcriptase activity expressed by Long Interspersed Nuclear Element (LINE)-1 (17% of Human DNA) have raised concerns about the long-term safety of messenger-RNA (mRNA) based vaccination. Forum Conversation: Norman Fenton On the Revelation of Pandemic Data - R W Malone - Substack - 21st November 2022
In an exclusive interview with the Community Forum, Norman Fenton, a veteran UK risk management professor and mathematician explains how the manipulation of pandemic data by scientists, government agencies and mainstream media supports a false narrative with devastating consequences. The COVID Jab's Mechanisms of Injury - The Epoch Times - 20th November 2022
The evidence is in the rising numbers of jabbed individuals who are now contracting – and dying from – COVID and other infections. Find out how two specific microRNA (not the same as mRNA) being found in those who got the shot are interfering with a key part of the immune system. Covid-19 Vaccine Induced Thrombotic Thrombocytopenia - Epoch Health - 8th November 2022
There are over 1000 peer-reviewed papers in the preprint server system and or in the National Library of Medicine (PUBMED) describing side effects after mRNA or adenoviral DNA COVID-19 vaccination. One of the most dreaded complications is vaccine-induced thrombotic thrombocytopenia (VITT). G20 Promotes WHO-Standardized Global Vaccine Passport and 'Digital Health' Identity Scheme - The Epoch Times - 17th November 2022
Leaders of the Group of 20 (G20) have issued a joint declaration promoting a global standard on proof of vaccination for international travel and calling for the establishment of “global digital health networks” that build on existing digital COVID-19 vaccine passport schemes. Science For Hire Depopulation by Vaccines Documentary - Rumble - 11th November 2022
A tale of corruption and the death of real science and freedom. A new pre-print answers some questions about age-related immunopathologies associated with empty LNPs - Jessica Rose - Substack - 16th November 2022A new preprint was uploaded on November 7, 2022 entitled: “Lipid nanoparticles (LNP) induce activation and maturation of antigen presenting cells in young and aged individuals” by a ‘non-conflicted group of researchers’ from… Acuitas? Wait, what?
This is worth writing a paper about, all on its own. What the ONS Mortality COVID-19 Surveillance Data can tell us about Vaccine Safety and Efficacy - ResearchGate - November 2022
"There is also now strong evidence that the ONS underestimates the proportion of unvaccinated, which leads to inflated mortality rates for the unvaccinated relative to the vaccinated. This underestimation is a major issue: the ONS claimed in May 2022 that 8% of adults are unvaccinated whereas the UKHSA estimated approximately 20% and an extensive and representative ICM survey estimated 26%. Because the ONS data are based on a subset of England residents that excludes all those not registered with a GP and not registered in the 2011 census, it is missing some 8 million adults who are not at all representative of those in the ONS sample." How the FDA and CDC Are Hiding COVID jab Dangers - The Epoch Times - Joseph Mercola - 11th November 2022
A new Scandinavian study confirms that vaccinated individuals are at greater risk for circulatory concerns and issues involving the larger organs – the same signals popping up in the FDA surveillance data. So why aren’t doctors and officials concerned – and worse, why are they hiding the data? Endocrinologist Forecasts More Hormone-Related Diseases as Spik Proteins Found to Deplete Endocrine 'Reserves' - Epoch Health - 1st November 2022
Dr. Flavio Cadegiani, a Brazilian endocrinologist, suspects that the worst has yet to come for spike protein-induced diseases in the endocrine system. The endocrine system, colloquially known as the hormone system, is critical for our health. It regulates growth and development, mood, metabolism, reproduction, immunity, and functions of other organs through the secretion of hormones. Censorship and Supression of Covid-19 Heterodoxy: Tactics and Counter-Tactics - Springer - 1st November 2022
"In the effort to silence alternative voices, widespread use was made not only of censorship, but of tactics of suppression that damaged the reputations and careers of dissenting doctors and scientists, regardless of their academic or medical status and regardless of their stature prior to expressing a contrary position. In place of open and fair discussion, censorship and suppression of scientific dissent has deleterious and far-reaching implications for medicine, science, and public health." Risk benefit analysis - UK Parliament debate - Dr John Campbell - 11th November 2022
Sir Christopher Chope, MP for Christchurch defends the vaccine injured. Reverse Transcription - Permanent Installation of mRNA Genetic Code - Courageous Discourse - 3rd November 2022
When we heard about Operation Warp Speed there was sense of shock and awe. American greatness was poised to strike the “China Virus” and it was going to be defeated in a matter of weeks. The Defense Advanced Research Projects Agency (DARPA) created a project many years ago called ADEPT Pandemic Prevention Platform (P3) whose stated goal was to “end pandemics in 60 days with mRNA technology.” Department of Defense Driving Mass Vaccination While FDA and Vaccine Companies are Powerless to Stop it - America Out Loud - 9th November 2022
In this issue of the Report, we have an exclusive interview with Alexandria (Sasha) Latypova, MBA, a former pharmaceutical executive, and independent analyst. Her prior reports on TrialSite News that deaths reported in VAERS after COVID-19 vaccination are not randomly distributed according to manufacturing lots as they are with influenza vaccines. Instead, they are aggregated in specific “hot lots.” Children Suddenly Dying - 'It's Through The Roof' - Dr. Peter McCullough - Rumble - 4th November 2022
"Before the COVID19 vaccines, there were four cases for myocarditis per million..." - Dr. Peter McCullough "It's through the roof. myocarditis at this point in time is due to the COVID 19 vaccines until proven otherwise." - Dr. Peter McCullough Association Between Vaccines and EXCESS MORTALITY Getting Stronger - and is Discussed in UK Parliament - Igor Chudov - Substack - 6th November 2022
While we will be discussing the most unwelcome news of increased death rates, I am happy to report that a leading British Member of Parliament, Andrew Bridgen brought up, in the UK parliament no less, the relationship between vaccination and excess deaths. No, It's Not Just Like the Flu Vaccine - Epoch Health - 1st November 2022
"The comparison between the annual flu vaccine and these COVID-19 boosters “is entirely misplaced,” Prasad argued. “It’s completely farcical. It’s absolutely wrong. And anyone who says it is pushing propaganda rather than science.” SARS-CoV-2 drives NLRP3 inflammasome activation in human microglia through spike protein - Molecular Psychiatry - 1st November 2022
"Mechanistically, we demonstrated that purified SARS-CoV-2 spike glycoprotein activated the NLRP3 inflammasome in LPS-primed microglia, in a ACE2-dependent manner." "These results support a possible mechanism of microglial innate immune activation by SARS-CoV-2, which could explain the increased vulnerability to developing neurological symptoms akin to Parkinson’s disease in COVID-19 infected individuals, and a potential therapeutic avenue for intervention." Atypical B cells and impaired SARS-CoV-2 neutralisation following booster vaccination in the elderly - MedRxiv - 13th October 2022
This expansion of atypical B cells and impaired T cell responses may contribute to the generation of less affinity-matured antibodies, with lower neutralizing capacity post-third dose in the elderly. Altogether, our data reveal the extent and potential mechanistic underpinning of the impaired vaccine responses present in the elderly after a booster dose, contributing to their increased susceptibility to COVID-19 infection. SARS-CoV-2 promotes microglial synapse elimination in human brain organoids - Molecular Psychiatry - 5th October 2022
"To a large extent, SARS-CoV-2 exposed microglia adopt a transcriptomic profile overlapping with neurodegenerative disorders that display an early synapse loss as well as an increased incident risk after a SARS-CoV-2 infection. Our results reveal that brain organoids infected with SARS-CoV-2 display disruption in circuit integrity via microglia-mediated synapse elimination and identifies a potential novel mechanism contributing to cognitive impairments in patients recovering from COVID-19." (UPDATED) Exclusive Summary: Covid-19 Vaccine Concerns - Sharyl Attkisson - 28th October 2022
If you find yourself confused about the mixed guidance when it comes to Covid-19 vaccines and safety concerns, you’re not alone. While the Centers for Disease Control (CDC) is marketing widespread use of the vaccines in the U.S. for both old and young alike; many other countries have limited Covid-19 vaccine use under certain conditions. Health officials around the world are giving varying advice on safety issues as Covid-19 vaccines are given to more people, and more information is collected. Episode 291: DEADLY PROTOCOLS - The Highwire - 27th October 2022
ICAN Set to Sue Your State; Bombshell V-Safe Finding; NY Court Rules For Unvaxxed; ICAN National Poll Reveals Biggest Voting Block; A Deadly Protocol; GUESTS: JP Sears; Sarah Mitchell, RN, BSN, C-EFM; Stacy Ograyensek Vaccinating After Recovering From COVID-19 - Epoch Health - 1st November 2022
Begging for trouble with blood clots With each COVID-19 infection there is exposure to the Spike protein on the surface of the virus. This protein causes a world of trouble including damaging blood vessels and causing blood clots. When the virus infects the nose, with nasal washes and gargles and other treatments in the McCullough Protocol©, the degree of viral invasion in the body should be negligible. Editor-in-chief of Renowned Science Journal Ousted for Publishing Science Questioning COVID-19 Vaccine Safety - Epoch Health - 30th October 2022
Dr. José Luis Domingo, who has served as editor-in-chief of a prestigious scientific journal, Food and Chemical Toxicology (FCT), for the past seven years, said that he has essentially been forced to resign. His resignation, he alleged, has come about because of gaping problems with scientific integrity and industry influence when it comes to scientific discussions about the safety of the COVID-19 vaccines. mRNA Vaccines Injure the Heart of ALL Vaccine Recipients and Cause Myocarditis in Up to 1 in 27, Study Finds - The DailySceptic - 27th October 2022
New evidence has emerged that the mRNA COVID-19 vaccines are routinely injuring the heart of all vaccine recipients, raising further questions about their safety and their role in the recent elevated levels of heart-related deaths. The latest evidence comes in a study from Switzerland, which found elevated troponin levels – indicating heart injury – across all vaccinated people, with 2.8% showing levels associated with subclinical myocarditis. Innate immune supression by SARS-CoV-2 mRNA vaccinations: The role of G-quadruplexes, exosomes, and MicroRNAs - PubMed - 15th April 2022
"In this paper, we present evidence that vaccination induces a profound impairment in type I interferon signaling, which has diverse adverse consequences to human health. Immune cells that have taken up the vaccine nanoparticles release into circulation large numbers of exosomes containing spike protein along with critical microRNAs that induce a signaling response in recipient cells at distant sites. We also identify potential profound disturbances in regulatory control of protein synthesis and cancer surveillance. These disturbances potentially have a causal link to neurodegenerative disease, myocarditis, immune thrombocytopenia, Bell's palsy, liver disease, impaired adaptive immunity, impaired DNA damage response and tumorigenesis. We show evidence from the VAERS database supporting our hypothesis. We believe a comprehensive risk/benefit assessment of the mRNA vaccines questions them as positive contributors to public health." Why Do Vaccines Consistently Fail to Prevent Disease Transmission? - Substack - 26th October 2022
Many of you have been treated in horrific ways by your friends and family throughout the pandemic for refusing to adopt the nonsensical or dangerous pandemic management strategies that were force-fed to us by the media. Antibody responses to Omicron BA.4/BA.5 bivalent mRNA vaccine booster shot - BioRxiv - 22nd October 2022
"When given as a fourth dose, a bivalent mRNA vaccine targeting Omicron BA.4/BA.5 and an ancestral SARS-CoV-2 strain did not induce superior neutralizing antibody responses in humans, at the time period tested, compared to the original monovalent vaccine formulation." COVID Vaccinated Young Adults are 92% more likely to die than Unvaccinated Young Adults according to UK Government - The Expose - 26th October 2022
Official figures published by the UK’s Office for National Statistics show that deaths per 100,000 among double vaccinated 18-39-year-olds were on average 91% higher than deaths per 100,000 among unvaccinated 18-39-year-olds between January 2021 and January 2022. This means it can no longer be denied that the Covid-19 vaccines are deadly because even the official Government published figures now prove it. Dr. Robert Malone: The Annual Flu Vaccine Program Is 'Built on a Lie' - Rumble - The Vigilant Fox - 23rd October 2022
Dr. Robert Malone, the inventor of mRNA vaccine technology, voiced some strong opinions about the flu shot at the Florida COVID Summit. Take a listen. "It's wrapped around the idea that we should coerce the population to take a product on an annual basis so that we can maintain warm base manufacturing in case something like 1918 ever happens again. And it's all built basically on a lie." 'Speed of Science' - A Scandal Beyond Your Wildest Nighmare - The Epoch Times - 24th October 2022
It was never about data or science; it was about following the top-down script they had from the beginning. And this recent admission by a Pfizer executive proves it would be called out as fraudulent in any other industry. So how have they managed to pull the wool over so many people’s eyes? Breaking Agrawal et al.: "Severe COVID-19 outcomes after full vaccination of primary schedule and initial boosters: pooled analysis of national prospective cohort studies of 30 million individuals - The Lancet - 24th October 2022
England, Northern Ireland, Scotland, and Wales; found an increased risk of severe COVID-19 outcomes beginning 10 weeks after completing the primary vaccination schedule. I guess I should also take a crack at the new mod(e)rna data in the NEJM - Jessica Rose - Substack 22nd October 2022
Please head to the latest New England Journal of Medicine (NEJM) article entitled: “Evaluation of mRNA-1273 Vaccine in Children 6 Months to 5 Years of Age” published on October 21,2022. It’s a late assessment of the ‘unknown’ “safety, reactogenicity, immunogenicity, and efficacy of the mRNA-1273 coronavirus disease 2019 (Covid-19) vaccine in young children”. It’s not even funny how they are publishing this assessment of unknown safety factors 4 months AFTER they starting injecting children ages 6 months to 5 years of age. I have been bitching about this for a long time now. Endonuclease fingerprint indicates a synthetic origin of SARS-CoV-2 - BioRxiv - 18th October 2022
"The restriction map of SARS-CoV-2 is consistent with many previously reported synthetic coronavirus genomes, meets all the criteria required for an efficient reverse genetic system, differs from closest relatives by a significantly higher rate of synonymous mutations in these synthetic-looking recognitions sites, and has a synthetic fingerprint unlikely to have evolved from its close relatives. We report a high likelihood that SARS-CoV-2 may have originated as an infectious clone assembled in vitro." Time for Doctors and Politicains to Stop Ignoring the Devastating Data on the Vaccines and Change Course - The DailySceptic - 21st October 2022
Aside from lobbying for changes in Covid polices, a key purpose of the 50-plus open letters that the U.K. Medical Freedom Alliance has written to Government, regulators, decision-makers and individuals over the last two and a half years has been to create a paper trail of accountability. When the day of reckoning eventually arrives, these publicly published and dated letters provide evidence that those making and implementing destructive and unethical policies cannot claim that they were unaware of the potential harms of their actions. Unvaccinated Children Are "Our Only Hope" in Generating Herd Immunity: Vaccine Expert - The Epoch Times - 20th October 2022For nearly two years, vaccine expert and virologist Geert Vanden Bossche has been on a mission to raise awareness of why healthy children should not receive COVID-19 vaccines.
Vanden Bossche, who has 30 years of experience in the vaccine industry, claims that it is primarily the unvaccinated children and adults who can generate herd immunity. One in Every 500 Small Children Who Receive the Pfizer Vaccine are Hospitalised By It, Study Finds - The DailySceptic - 20th October 2022
One in every 500 children under five years who received the Pfizer mRNA Covid vaccine were hospitalised with a vaccine injury, and one in 200 had symptoms ongoing for weeks or months afterwards, a study has found. Lab in Boston Made What Could Be A Super-Killer SARS-CoV2 - Dr. Byram Bridle - Substack - 18th October 2022
"I was in shock when a couple of my colleagues directed me to a pre-print article that was posted online on Friday October 14, 2022. Pre-prints are scientific papers that have not yet undergone peer review and they have not been published in a journal. In this case, these nuances are moot. What is far more important is the product that has been described, along with the disclosure of the recipe to make it." Boom! Stanford's John Ioannidis proves Again what I, Risch, McCullough, Atlas, J Tucker, Tenenbaum, Bhattacharya, Gupta, Kulldorff, Wolf, Oskoui knew, COVID was NOT deadly for vast majority, Low IFR - Paul Alexander - Substack - 16th October 2022
"Two years ago I wrote this in AIER (under Tucker and Eastman) with Risch and Tenenbaum and Dara and McCullough and Oskoui, working with Ioannidis and his data, listening, sharing, we knew the risk was near zero. For the younger, healthy, well, even middle-aged persons. No one ever said that this was not serious for the elderly and high risk who we call ‘elderly’ elderly. But we knew how to manage them then with early treatment and support and who the risk group was." Age-stratified infection fatality rate of COVID-19 in the non-elderly informed from pre-vaccination national seroprevalence studies - MedRxiv - 11th October 2022
"The IFRs had a median of 0.035% (interquartile range (IQR) 0.013 - 0.056%) for the 0-59 years old population, and 0.095% (IQR 0.036 - 0.125%,) for the 0-69 years old. The median IFR was 0.0003% at 0-19 years, 0.003% at 20-29 years, 0.011% at 30-39 years, 0.035% at 40-49 years, 0.129% at 50-59 years, and 0.501% at 60-69 years. Including data from another 9 countries with imputed age distribution of COVID-19 deaths yielded median IFR of 0.025-0.032% for 0-59 years and 0.063-0.082% for 0-69 years. Meta-regression analyses also suggested global IFR of 0.03% and 0.07%, respectively in these age groups." Madmen, real Madmen, why would they create a chimeric SARS-CoV-2 virus with 80% mortality? - Dr. Paul Alexander - Substack - 15th October 2022
"Based on this pre-print by Chen et al., we are looking potentially at a chimera that could wipe out humanity. It is that serious for this was the same insanity we saw when Menachery and Baric et al. posted their 2015 paper telling us the insanity of what they just did in vitro and in vivo creating the gain-of-function very lethal and infectious chimera. “On the basis of these findings, we synthetically re-derived an infectious full-length SHC014 recombinant virus and demonstrate robust viral replication both in vitro and in vivo. Our work suggests a potential risk of SARS-CoV re-emergence from viruses currently circulating in bat populations.” Is UK's Depopulation Caused by Covid Vaccines? - Igor Chudov - Substack - 15th October 2022
Excess mortality in the UK, across deprivation quintiles, is almost entirely explained by Covid vaccination rates by quintile. Covid vaccination rate explains 94% of the differences and the relationship has great statistical significance P=0.0052! The 2022 decline in births in the UK, across deprivation quintiles, is similarly explained by Covid vaccination rates by quintile. Sneak Peek: Explosive Testimony From Doctors in New Film - The Real Anthony Fauci - Rumble - The Vigilant Fox - 15th October 2022
Robert F. Kennedy Jr.’s best-selling book, The Real Anthony Fauci, has been turned into a groundbreaking documentary film—and it's being released entirely free to the public on Tuesday, October 18, 2022. The most suppressed book of our generation may now be the most important documentary of our lifetime. FOIA Records Reveal CDC Is Trying to Hide Important Data on Vaccine Safety - The Epoch Times - 11th October 2022
When the experimental mRNA vaccines rolled out in the United States, the Centers for Disease Control and Prevention (CDC) had an operating manual for their immunization safety teams. These teams would monitor the nation’s vaccine adverse events database. And according to their procedures, they would look for safety signals on a weekly basis by comparing the COVID vaccines against another established vaccine like one for the flu. Moderna COVID-19 Vaccine Effectiveness Turns Negative within Months: Study - The Epoch Times - 10th October 2022
"However, against more recent strains, including the currently dominant BA.5, the effectiveness turned negative. Against BA.2, BA.4, and BA.5, the effectiveness went negative after 150 days; against BA.1.12.1, the effectiveness turned negative after 91 days." Severe COVID-19 induces autoantibodies against angiotensin II that correlate with blood pressure dysregulation and disease severity - Science Advances - 7th October 2022
"Here, we show that a significant proportion of hospitalized patients with COVID-19 developed autoantibodies against AngII, whose presence correlates with lower blood oxygenation, blood pressure dysregulation, and overall higher disease severity. Anti-AngII antibodies can develop upon specific immune reaction to the SARS-CoV-2 proteins Spike or receptor-binding domain (RBD), to which they can cross-bind, suggesting some epitope mimicry between AngII and Spike/RBD. These results provide important insights on how an immune reaction against SARS-CoV-2 can impair blood pressure regulation." Are the Kids OK? - Rumble - 5th October 2022
How did Pfizer recruit kids for its Covid-19 vaccine trial? Why was a New York hospital running an ad to bring in children? Watch this video and find out. Dr. Jessica Rose: Update on Fertility Data & VAERS - World Council for Health - 3rd October 2022
On Monday, October 3, Dr. Jessica Rose (Canada) spoke at WCH General Assembly 59, giving a presentation about VAERS and the latest fertility data. Hundreds of Thousands of Americans Sought Medical Care After COVID-19 Vaccination: CDC Data - The Epoch Times -3rd October 2022
"Roughly 782,900 people reported seeking medical attention, emergency room care, and/or hospitalization following COVID-19 vaccination. Another 2.5 million people reported needing to miss school, work, or other normal activities as a result of a health event after getting a COVID-19 vaccine.The reports were made to the CDC’s V-safe program, a new vaccine safety monitoring system to which users can report issues through smartphones." Vaccinated Mother's Dying Newborn with "White Lungs" - Igor Chudov - Substack - 1st October 2022
Baffled Doctor blames "Asymptomatic Covid" -- which was never diagnosed! It turns out that the "PRRARSV" motif is more than a furin-cleavage site - Unacceptable Jessica - Substack - 1st October 2022
More evidence to support the construction hypothesis? There’s been a lot of debate about the Pradhan paper1: a paper that had a short life span on the bioRxiv pre-print server a while back - Jan. 31, 2020 - to be precise. It showed the presence of four unique inserts in the SARS-nCoV-2 genome that are not present in any other coronaviruses, including SARS-nCoV (I might refer to the original SARS as ‘original recipe chicken’ in this article, or some variation of this). “How did they get there?” was the question of the day. And “Why was the paper really withdrawn by the authors”? Will they rise to their intentions to ‘revise it in response to comments received from the research community on their technical approach and their interpretation of the results’? What does that even mean? And who exactly is this ‘research community’? Curing the Pandemic of misinformation on COVID-19 mRNA vaccines through real evidence-based medicine - Journal of Insulin Resistance - 26th September 2022
Results: In the non-elderly population the “number needed to treat” to prevent a single death runs into the thousands. Re-analysis of randomised controlled trials using the messenger ribonucleic acid (mRNA) technology suggests a greater risk of serious adverse events from the vaccines than being hospitalised from COVID-19. Pharmacovigilance systems and real-world safety data, coupled with plausible mechanisms of harm, are deeply concerning, especially in relation to cardiovascular safety. Mirroring a potential signal from the Pfizer Phase 3 trial, a significant rise in cardiac arrest calls to ambulances in England was seen in 2021, with similar data emerging from Israel in the 16–39-year-old age group. COVID-19 Vaccines: The Impact on Pregnancy Outcomes and Menstrual Function - Preprints.org - 28th September 2022
Results: COVID-19 vaccines, when compared to the Influenza vaccines are associated with a significant increase in AE with all proportional reporting ratios of > 2.0: menstrual abnormality, miscarriage, fetal chromosomal abnormalities, fetal malformation, fetal cystic hygroma, fetal cardiac disorders, fetal arrhythmia, fetal cardiac arrest, fetal vascular mal-perfusion, fetal growth abnormalities, fetal abnormal surveillance, fetal placental thrombosis, low amniotic fluid, and fetal death/stillbirth (all p values were much smaller than 0.05). When normalized by time-available, doses-given, or persons-received, all COVID-19 vaccine AE far exceed the safety signal on all recognized thresholds. Freeman interviews Dr. Aseem Malhotra - Rumble - 26th September 2022
New peer reviewed evidence calls for all Covid-19 vaccines to be withdrawn. JAMA: mRNA Vaccine Shedding in Breast Milk Proven! - Igor Chudov - Substack - 27th September 2022
The times are changing! Remember how we said that vaccine shedding is a real thing and breastfeeding after vaccination is dangerous? Our warnings were dismissed as “misinformation” and we were cast as ignorant, science-denying cranks. Episode 286: Septic Science - The Highwire - 22nd September 2022The Remdesivir Lawsuits; Big Tech Censorship Lawsuit Heats Up; ICAN FOIA: CDC Celebrated Censorship of Del Bigtree; Septic Science; #TrudeauMustGo
GUESTS: Daniel Watkins, Michael Hamilton, Paul Marik, M.D., Pierre Kory, M.D. Potential Temporal Association Found Between Guillain-Barre Syndrome and COVID-19 Vaccination in Pediatrics - NeurologyLive - 22nd September 2022
From the pre-COVID period to 6 weeks after vaccination, the reporting rate of GBS was significantly different, regardless of whether Brighton criteria was applied to the analysis. The authors noted that passive surveillance limitations warrant further analysis. Ob/Gyn Warns of Possible Links between mRNA Injections, Miscarriages and Malformations - DailyClout - 12th September 2022Dr. Naomi Wolf joins Ob-Gyn Dr. James Thorp to discuss the dangers of the COVID vaccine to pregnant women.
Dr. Thorp explains cases of swollen lymph nodes in pregnant women, as well as other instances of inflammation caused by lipid nanoparticles, throughout the mother’s body and especially affecting the placenta. This inflammation disrupts, he warns, the development of the child. The lipid nanoparticles also traverse every membrane, including the placenta, and concentrate in the blood of the baby. The heart and the brain of the child are also vulnerable to absorbing the lipid nanoparticles. Lymph node problems, malformations of the fetus, immune deficiencies, chromosomal abnormalities, tumors, restricted growth and other problems in babies are, he says, resulting. This is What the Unvaxxed Had to Endure the Past 2 Years - Rumble - Chief Nerd - 11th September 2022
Constant division of society - constant propaganda - constant dehumanising of the unvaccinated - constant stirring up anger and resentment - constant barefaced lies. Where are the apologies? "Health Experts" are baffled by shocking increase in Excess Deaths but the rest of us knew it would happen - The Expose - 18th September 2022
The Scottish government has started an inquiry into the causes of excess deaths during the Covid-19 pandemic in Scotland. Beyond Scotland, other areas of the UK also experienced an unexplained rise in excess deaths. According to the latest data from the UK’s Office for National Statistics (“ONS”), from June to late August 2022, around 1,000 excess deaths took place in England and Wales each week. However, most of them are unrelated to the Covid-19 pandemic. Currently, many baffled and worried health experts in the UK are calling for an urgent government investigation into these excess deaths. Updated Moderna COVID-19 Booster Didn't Improve Clinical Efficacy: Study - The Epoch Times - 19th September 2022
Moderna's updated COVID-19 vaccine was not more effective at preventing COVID-19 infection, according to a new study. Researchers funded by Moderna analyzed the updated shot, which contains elements of the Wuhan virus strain and the BA.1 strain, in comparison to the old booster, which was only targeted at the Wuhan variant. They recorded more participants contracting COVID-19 in the group who received the updated booster. Serious adverse events of special interest following mRNA COVID-19 vaccination in randomized trials in adults - ScienceDirect - 31st August 2022
The Pfizer trial exhibited a 36 % higher risk of serious adverse events in the vaccine group; risk difference 18.0 per 10,000 vaccinated (95 % CI 1.2 to 34.9); risk ratio 1.36 (95 % CI 1.02 to 1.83). The Moderna trial exhibited a 6 % higher risk of serious adverse events in the vaccine group: risk difference 7.1 per 10,000 (95 % CI –23.2 to 37.4); risk ratio 1.06 (95 % CI 0.84 to 1.33). Combined, there was a 16 % higher risk of serious adverse events in mRNA vaccine recipients: risk difference 13.2 (95 % CI −3.2 to 29.6); risk ratio 1.16 (95 % CI 0.97 to 1.39). 'Conscientious Objection' Reason Enough to Refuse mRNA Vaccines as preventative Treatment for COVID-19: Study - The Epoch Times - 14th September 2022
A Canadian paper published in a peer-reviewed international journal proposes that “conscientious objection” is an adequate reason to refuse mRNA vaccines as a preventive treatment against COVID-19. Children are being killed: 8X increase in Excess Deaths among Children in Europe since COVID Vaccine roll-out according to Official EU Data - The Expose - 13th September 2022
Official mortality figures for Europe show that there has been a shocking 691% increase in excess deaths among children since the European Medicines Agency extended the emergency use authorisation of the Pfizer Covid-19 vaccine for use in children aged 12 to 15 in May 100 Years,100 years after - of Natural immunity: we always knew from the study on Spanish Flu survivors showing serum-neutralizing activity against 1918 virus,; Fauci & Francis Collins & Birx KNEW it! - Dr. Paul Alexander - Substack - 11th September 2022
They always knew they were lying to drive you to get vaccinated, they knew that the natural immunity was optimal and robust and life-long and no vaccine was needed if you were COVID recovered. Covid-19 vaccine boosters for young adults: A risk-benefit assessment and five ethical arguments agasinst mandates at universities - SSRN - 31st August 2022
Students at North American universities risk disenrollment due to third dose Covid-19 vaccine mandates. We present a risk-benefit assessment of boosters in this age group and provide five ethical arguments against mandates. Leaked Video Suggests Israeli Health Officials Covered Up Serious Safety Problems With Pfizer COVID Vaccine - The Defender - 8th September 2022
A leaked video recording reveals researchers in June shared data with the Israeli Ministry of Health showing serious and long-term side effects associated with Pfizer’s COVID-19 vaccine, but Israeli health officials told the public in an August report that serious side effects were “rare” and short-term. Bakshi & Khayat - Khoei et al.: "COVID-19 mRNA vaccination leading to CNS inflammation: a case series"
Dr. Paul Alexander - Substack - 5th September 2022 "From 1 to 21 days of either 1st or 2nd COVID vaccine, patients developed neurologic symptoms & MRI findings consistent with active CNS demyelination of optic nerve, brain, &/or spinal cord". The Highwire Episode 283: A NEW HOPE
Ivermectin Bombshell Exposes Hit; Big Win in People’s Republic of California; Zuckerberg Outs the FBI; WEF’s Digital Army; Court Wins Accumulate; A New Hope for Public HealthGuests: Amy Bohn, Joseph Ladapo, MD, PhD. Vascular and organ damage induced by mRNA vaccines: irrefutable proof of causality - Doctors4covidethics.org - 19th August 2022
We note that the damage mechanism is which emerges from the autopsy studies is not limited to COVID-19 vaccines only but is completely general—it must be expected to occur similarly with mRNA vaccines against any and all infectious pathogens. This technology has failed and must be abandoned. Documentary: 'Uninformed Consent - The Epoch Times - 23rd August 2022
Just as antisemitism was normalized through propaganda in 1930s Germany, the same exact strategy was used during the COVID pandemic – and we paid for this abuse, while the ‘elite’ class profited from this intentional, slow-motion train wreck. It’s time to expose everything. Subclinical Myocarditis: The Silent Killer - "There is No Heart Damage That's Mild or Inconsequential" - Rumble - 13th August 2022
Dr. Peter McCullough: "The reason why myocarditis is so important in children is that when there's superimposed adrenaline and noradrenaline in exercise, it is the trigger for cardiac arrest." Young children should not be vaccinated with any type of smallpox vaccine, says Dr. Geert Vanden Bossche - The Expose - 19th August 2022Vaccination of vulnerable groups (sexual minority communities) against monkeypox is likely to accelerate the adaptive evolution of monkeypox in highly Covid vaccinated populations. It could thereby raise the incidence of (severe) monkeypox disease in vulnerable subsets of non-Covid vaccinated individuals and ignite multi-country epidemics of monkeypox in non-Covid vaccinated animal and human populations that are immunologically naïve to orthopoxvirus, wrote Dr. Geert Vanden Bossche.
Patient Betrayal: The Corruption of Healthcare, Informed Consent and the Physician-Patient Relationship - TheGMS - 1st March 2022
Conclusions ABOG and other authoritative bodies regulating healthcare workers issued inappropriate gag orders on their constituents, thus preventing informed consent and destroying physician-patient relationships. Many reputable sources of data, medical literature and VAERS signal DANGER for the use of COVID-19 vaccines, especially during pregnancy and in women of reproductive age. ABOG must retract their inappropriate threats and recommend against the use of COVID-19 “vaccination” in pregnancy until long-term prospective trials are conducted. Vaccine effectiveness of two-dose BNT-162b2 against symptomatic and severe COVID-19 among adolescents in Brazil and Scotland over time: a test negative case-control study - The Lancet - 8th August 2022
"We found waning vaccine protection of BNT162b2 against symptomatic COVID-19 infection among adolescents in Brazil and Scotland from 27 days after the second dose. However, protection against severe COVID-19 outcomes remained high at 98 days or more after the second dose in the omicron-dominant period." PfizerGate: Official Government Reports prove Hundreds of Thousands of People are dying every single week due to Covid-19 Vaccination - The Expose - 14th August 2022
"You were instructed to stay at home to protect the healthcare system. But while you did so, hospitals essentially had a holiday, and this is backed up by official data. You were told the answer to everyone’s prayers was to get the Covid-19 injection. But now that you have done so, the healthcare system is on the brink of collapse." Cardiovascular Effects of the BNT162b2 mRNA COVID-19 Vaccine in Adolescents - Preprints - 8th August 2022
Conclusion: Cardiovascular effects in adolescents after BNT162b2 mRNA COVID-19 vaccination included tachycardia, palpitation, and myocarditis. The clinical presentation of myopericarditis after vaccination was usually mild, with all cases fully recovering within 14 days. Hence, adolescents receiving mRNA vaccines should be monitored for side effects. 1 in every 246 Vaccinated People has died within 60 days of Covid-19 Vaccination in England according to UK Government - The Expose - 9th August 2022
The UK Government has revealed that 1 in every 246 people vaccinated against Covid-19 in England has died within 60 days of receiving a dose of the Covid-19 vaccine. Risk of Heart Inflammation Remains Elevated After COVID-19 Booster: Study - The Epoch Times - 6th August 2022
"The risk of heart inflammation following receipt of a COVID-19 booster shot remains elevated, according to a new study. The primary series of the messenger RNA-based vaccines, made by Pfizer and Moderna, have already been linked to heart inflammation, but not as much research has been done on whether booster doses also present heart-related risks." Japanese Surgeon Calls for Suspension of COVID Boosters - The Epoch Times - 3rd August 2022
In a letter to the peer-reviewed journal Virology, a Japanese cardiovascular surgeon, Dr. Kenji Yamamoto, has called for the discontinuation of COVID-19 booster shots. “As a safety measure, further booster vaccinations should be discontinued,” Yamamoto wrote. Among his urgent concerns are the fact that the COVID-19 vaccines have been linked to vaccine-induced immune thrombotic thrombocytopenia, which, in some cases, has been lethal to patients. Coronavirus spike protein activated natural immune response, damaged heart muscle cells, study finds - American Heart Association - 25th July 2022
Researchers have demonstrated a potential route of the SARS-CoV-2 spike protein damaging the heart. In a study evaluating mice and human heart cells, the SARS-CoV-2 spike protein inflamed the heart muscle cells, which can lead to heart injury. Dose-Dependent Hospitalizations: Shocking New South Wales Government Data Uncovers the Lies - The Vigilant Fox - Substack - 30th July 2022"We’ve long been propagandized since the vaccine rollout that this is a pandemic of the unvaccinated, that those who elected to avoid the experimental gene therapy account for over 90% of COVID-19 hospitalizations and deaths."
Dr. Ryan Cole: Health & Wellness Have Been Badly Spiked - World Council For Health - 25th July 2022
Dr. Ryan Cole is an Anatomic & Clinical Pathology Specialist with over 25 years of experience in the medical field who has trained at the Mayo Clinic. In 2004, he founded Cole Diagnostics, an independent, full-service medical laboratory in Boise, Idaho. Bossche and Alexander: Paediatricians and parents do not vaccinate your children with these COVID vaccines - Rumble - 22nd July 2022Dr. Geert Vanden Bossche and Dr. Paul Elias Alexander discuss the harms and death from the COVID vaccines.
My content is available for free. I have lost extensive income due to my advocacy for early treatment and my stance against the COVID vaccines, especially for children. Vaccines Are Destroying People's Immunity Through 'Immune Imprinting': Dr. Robert Malone [Part 1] - The Epoch Times - 21st July 2022
"The question is, why are these people that have had these repeated vaccinations, the ones that are getting the more severe infections, disease, and death? It’s a paradox. There’s a known phenomenon within the vaccine scientific community called "immune imprinting,” where it’s understood that frequent vaccinations can push out existing immunity within people. This has become a growing concern among experts with the COVID-19 vaccines, since people are being mass vaccinated for virus strains that are largely defunct; and as the virus continues to mutate, the vaccine is becoming less effective. Protection of SARS-CoV-2 natural infection against reinfection with the Omicron BA.4 or BA.5 subvariants - MedRxiv - 11th July 2022
"Effectiveness of a previous Omicron infection against symptomatic BA.4/BA.5 reinfection was 76.1% (95% CI: 54.9-87.3%), and against any BA.4/BA.5 reinfection was 79.7% (95% CI: 74.3-83.9%). Results using all diagnosed infections when BA.4/BA.5 dominated incidence confirmed the same findings." Reactogenicity of Simultaneous COVID-19 mRNA Booster and Influenza Vaccination in the US - JAMA Network - 15th July 2022
In this study, compared with administration of COVID-19 mRNA booster vaccines alone, simultaneous administration of COVID-19 mRNA booster and seasonal influenza vaccines was associated with significant increases in reports of systemic reactions during days 0 to 7 following vaccination. These results may help better characterize the outcomes associated with simultaneously administered COVID-19 booster and influenza vaccines in the US population. FDA Colluded With Moderna to Bypass COVID Vaccine Safety Standards, Documents Reveal - The Defender - 12th July 2022
According to Alexandra Latypova, an ex-pharmaceutical industry executive, documents obtained from the U.S. Department of Health and Human Services on Moderna’s COVID-19 vaccine suggest the U.S. Food and Drug Administration and Moderna colluded to bypass regulatory and scientific standards used to ensure products are safe. Genetic COVID Vaccines May Damage Children's Innate Immunity - Dr. Paul Alexander - Epoch TV - 14th July 2022
“The data was so profound that the UK decided to stop reporting at the end of March. … The infection rates in vaccinated persons, particularly after the second and third dose, were skyrocketing,” said Dr. Paul Alexander, an expert in evidence-based medicine, research methodology, and clinical epidemiology. He served in the Trump administration as a COVID policy adviser." Original Antigenic Sin: The Highly-Jabbed Are Breeding Variants and Perpetuating an Endless Pandemic - Rumble - 13th July 2022
Dr. Robert Malone: "It's called immune imprinting. And what the government has bought is the perfect vaccine combination to cause this to get even worse." Duration of immune protection of SARS-CoV-2 natural infection against reinfection in Qatar - MedRxiiv - 6th July 2022
"Effectiveness of primary infection against severe, critical, or fatal COVID-19 reinfection was 97.3% (95% CI: 94.9- 98.6%), irrespective of the variant of primary infection or reinfection, and with no evidence for waning. Similar results were found in sub-group analyses for those ≥50 years of age." Increasing SARS-CoV-2 cases, hospitalizations and deaths among the vaccinated elderly populations during the Omicron (B.1.1.529) variant surge in UK - MedRxiv - 28th June 2022
"CONCLUSIONS There is no discernable vaccine effectiveness among ≥18 years of age, vaccinated third dose population since the beginning of the Omicron variant surge. Pre-existing conditions, ethnicity, deprivation score, and vaccination rate disparities data need to be adjusted for evaluating VE for hospitalizations and deaths. The increased cases with significantly increased hospitalizations and deaths among the elderly population during the Omicron variant surge underscores the need to prevent infections in the elderly irrespective of vaccination status with uniform screening protocols and protective measures." Hungary: Most Vaccinated Counties Have Worst Birth Rate Drops! - Igor Chudov - Substack - 3rd July 2022
Interesting news on the birth rate drop front! It turns out that the most vaccinated counties of Hungary have the worst drop in birth rates in 2022! This is a within-country comparison, comparing Hungarians to Hungarians, for the same time period. Vaccine in Children Only 48% Effective Weeks After Second Dose - The Epoch Times - 3rd July 2022
An israeli study assessed the effectiveness of BNT162b2 COVID-19 vaccination (Pfizer) against the Omicron variant in children 5 to 11 years old using a large health care database and found the vaccine effectiveness (VE) to be 48 percent 7–21 days after dose 2 for symptomatic infection. Vaccine Pregnacy Risks
Spike in Miscarriages, Fetal Deaths, Uterus Shedding: Fertility Doctor on Vaccine Side Effects in Pregnant Women - The Epoch Times - 1st July 2022 In order to get a sense of what a fertility specialist is seeing on the front line, Facts Matter interviewed Dr. James Thorp, a physician MD board-certified in obstetrics and gynecology, as well as maternal-fetal medicine. Dr. Thorp has practiced obstetrics for over 42 years and sees 6,000–7,000 high-risk pregnant patients a year. From his experience, Dr. Thorp said that although he has seen a spike in fetal death and adverse pregnancy outcomes after the mass vaccination campaign began, his attempts to quantify this effect have been hampered by the imposition of gag orders on physicians and nurses that were imposed in September 2021. Eulogy for a selfless Truth Warrior - R.W Malone - Substack - 1st July 2022
Vladimir (Zev) Zelenko (1973-2022), in his own words Dallas, Texas) – It is with immense sorrow that we announce the passing of our founder Dr. Vladimir “Zev” Zelenko. Dr. Zelenko was a physician, scientist, and activist for medical rights who touched the lives of millions of people. Some were saved as his role as a doctor, and even more were inspired by his words. His “Zelenko Protocol” saved millions and earned him a Nobel Prize nomination and the admiration of a U.S. President among other prominent world leaders. FDA Panel Votes to Waive Clinical Trials for New COVID Boosters - Truth Unmuted - 30th June 2022
The U.S. Food and Drug Administration’s (FDA) vaccine advisory panel on Tuesday voted 19 to 2 to recommend new COVID-19 booster shots that include the Omicron variant this fall. The "Future Framework", a FDA regulatory scheme that would allow Pfizer & Moderna to "reformulate" COVID-19 mRNA vaccines in perpetuity, without conducting clinical trials on the new vaccines - Dr. Paul Alexander - Substack - 28th June 2022
‘Future Framework”….get to know that term.This meeting happens today and this is the insanity we face as a US nation, how the FDA and the governmental agencies are now completely corruptible and unscientific. Bought and paid for by the pharmaceuticals and special interests. Something very wrong is happening in the US and these agencies, CDC, FDA etc. must be stripped down to the studs and every high level person fired. Age and sex-specific risks of myocarditis and pericarditis following Covid-19 messenger RNA vaccines - Nature - 25th June 2022
"We perform matched case-control studies and find increased risks of myocarditis and pericarditis during the first week following vaccination, and particularly after the second dose, with adjusted odds ratios of myocarditis of 8.1 (95% confidence interval [CI], 6.7 to 9.9) for the BNT162b2 and 30 (95% CI, 21 to 43) for the mRNA-1273 vaccine. The largest associations are observed for myocarditis following mRNA-1273 vaccination in persons aged 18 to 24 years." Vaccinated V Unvaccinated Study - NOTB - 23rd June 2022
The holy grail to end all discussion on vaccine safety has always been a simple vaccinated versus jab-free study. In February 2019 Oregon Pediatrician Dr. Paul Thomas was challenged by his state local Medical Board to prove his alternative care plan was safer than the standard 70 jab + CDC schedule. He hired an outside expert to analyse his patients data, a pool of resources from 2700 vaccinated and 560 unvaccinated children. FDA unanimously approve covid vaccine for 0-4 years - Hart - 16th June 2022
Unfathomable decision given the trial data The FDA met on 15th June and despite all the evidence of non-efficacy from the infant Pfizer vaccine and the still total lack of data on long-term harms, they voted to go ahead. If the last eighteen months are anything to go by, the MHRA will follow soon, followed after a respectable few weeks by the JCVI. Indeed, vaccination for this age-group is already listed for JCVI discussion. Before the UK regulators make any decision, they would do well to read a detailed letter to the FDA from Robert F Kenedy. Most healthcare interventions tested in Cochrane Reviews are not effective according to high quality evidence: a systematic review and meta-analysis - Science Direct - 17th April 2022
"In this large sample of 1,567 interventions studied within Cochrane reviews, effects of most interventions (94%) interventions were not supported by high-quality evidence. Potential harms of healthcare interventions were measured more rarely than benefits. Patients, doctors, and policy makers should consider the lack of high-quality evidence supporting the benefits and harms of many interventions in their decision-making." Serious Adverse Events of Special Interest Following mRNA Vaccination in Randomized Trials - SSRN - 23rd June 2022
"Discussion: The excess risk of serious adverse events found in our study points to the need for formal harm-benefit analyses, particularly those that are stratified according to risk of serious COVID-19 outcomes such as hospitalization or death." BA.2.12.1, BA.4 and BA.5 escape antibodies elicited by Omicron infection - Nature - 17th June 2022
"Together, our results indicate that Omicron may evolve mutations to evade the humoral immunity elicited by BA.1 infection, suggesting that BA.1-derived vaccine boosters may not achieve broad-spectrum protection against new Omicron variants." Fact Check: Covid as a Leading Cause of Death in Children - Pediatric News/ By Kelley - 8th June 2022
In the CDC ACIP meeting on June 17 to discuss childhood Covid vaccines, a table was presented showing Covid was a leading cause of death in US children as part of a slide deck on the epidemiology of Covid-19 in children and adolescents by Dr. Katherine Fleming-Dutra. The source was a pre-print written by a group of academics from the UK, including Dr. Deepti Gurdasani, who is well-known on Twitter for her strong views on Covid. I later learned that a very similar slide was also presented at the beginning of the FDA VRBPAC meeting earlier in the week. Neurotoxic amyloidogenic peptides in the proteome of SARS-COV2: potential implications for neurological symptoms in COVID-19 - Nature Communications - 13th June 2022
"COVID-19 is primarily known as a respiratory disease caused by SARS-CoV-2. However, neurological symptoms such as memory loss, sensory confusion, severe headaches, and even stroke are reported in up to 30% of cases and can persist even after the infection is over (long COVID). These neurological symptoms are thought to be produced by the virus infecting the central nervous system, however we don’t understand the molecular mechan-isms triggering them. The neurological effects of COVID-19 share similarities to neurode- generative diseases in which the presence of cytotoxic aggregated amyloid protein or peptides is a common feature. Following the hypothesis that some neurological symptoms of COVID-19 may also follow an amyloid etiology we identified two peptides from the SARS- CoV-2 proteome that self-assemble into amyloid assemblies. Furthermore, these amyloids were shown to be highly toxic to neuronal cells. We suggest that cytotoxic aggregates of SARS-CoV-2 proteins may trigger neurological symptoms in COVID-19" Self-reported outcomes, choices and discrimination among a global COVID-19 unvaccinated cohort - ResearchGate - June 2022
Results from a preliminary analysis of self-reported, self-selected survey results from a sub-cohort of >300,000 participants of the Control Group Cooperative project to understand more about their health outcomes, choices and any discrimination faced Global Vax Insanity: Dr. Ryan Cole Joins Greg Hunter [Video Interview] - Red Voice Media - 8th June 2022
Doctors are 'baffled' by the increase in Sudden Adult Death Syndrome (SADS) - Dr. Ryan Cole discusses this topic and more. Members of Congress Demand Answers - R.W.MaloneMD - Substack - 9th June 2022
Eighteen sitting Congressional members wrote a strong letter to the FDA demanding answers prior to the decision by regulators to approve COVID-19 vaccines for babies and young children aged 6 months to 4 years old. The FDA VRBPAC advisory panel is scheduled to meet on June 15 to discuss authorization and this letter addresses the fact that there are questions and facts that the FDA must consider prior to EUA authorization. Sars-CoV-2 was Lab Made Under Project DEFUSE - Igor Chudov - Substack 22nd May 2022
This long article will explain how Sars-Cov-2, the virus that causes COVID-19, was created as a result of intentional laboratory work. It will also show that the blueprint for Sars-Cov-2 was described in the “Project DEFUSE” proposal by Peter Daszak, which was preceded by years of relevant lab work and virus manipulation. Multisystem Inflammatory Syndrome after Breakthrough SARS-CoV-2 Infection in 2 Immunized Adolescents, United States - Emerging Infectious Diseases - July 2022
"Eight weeks after having laboratory-confirmed SARS-CoV-2 breakthrough infections, 2 otherwise healthy, fully immunized adolescent patients in the United States who were experiencing related signs and symptoms were diagnosed with multisystem inflammatory syndrome in children. Our findings indicate that COVID-19 vaccination does not completely protect adolescents against multisystem inflammatory syndrome." NHS reveals in FOI that Ambulance Call-outs for Heart Illness have DOUBLED since Covid-19 Vaccination began among all age-groups - the Expose - 6th June 2022
The National Health Service has confirmed in response to a freedom of information request that ambulance call-outs relating to immediate care required for a debilitating condition affecting the heart nearly doubled in the whole of 2021 and are still on the rise further in 2022. But the most concerning published figures show that they have also doubled among people under the age of 30. The Incidence fo Myocarditis and Pericarditis in Post COVID-19 Unvaccinated Patients - A Large Population-Based Study - MDPI - 15th April 2022
"Post COVID-19 infection was not associated with either myocarditis (aHR 1.08; 95% CI 0.45 to 2.56) or pericarditis (aHR 0.53; 95% CI 0.25 to 1.13). We did not observe an increased incidence of neither pericarditis nor myocarditis in adult patients recovering from COVID-19 infection." Adverse effects following anti-COVID-19 vaccination with mRNA-based BNT162b2 are alleviated by altering the routine administration and correlate with baseline enrichment of T and NK cell genes - PLOS Biology - 31st May 2022
"Herein, we found that higher baseline expression of genes related to T and NK cell exhaustion and suppression were positively correlated with the development of moderately severe fatigue after Pfizer-BioNTech BNT162b2 vaccination; increased expression of genes associated with T and NK cell exhaustion and suppression reacted to vaccination were associated with greater levels of innate immune activation at 1 day postvaccination." Increased emergency cardiovascular events among under-40 population in Israel during vaccine rollout and third COVID-19 wave
Nature - 28th April 2022 "Using a unique dataset from Israel National Emergency Medical Services (EMS) from 2019 to 2021, the study aims to evaluate the association between the volume of cardiac arrest and acute coronary syndrome EMS calls in the 16–39-year-old population with potential factors including COVID-19 infection and vaccination rates. An increase of over 25% was detected in both call types during January–May 2021, compared with the years 2019–2020. Using Negative Binomial regression models, the weekly emergency call counts were significantly associated with the rates of 1st and 2nd vaccine doses administered to this age group but were not with COVID-19 infection rates." Synthetic mRNA Suppresses Immune System, Possibly Leads to Cancer, Blood Clots, Fertility Issues, Spontaneous Abortions: Dr Malone - Facts Matter - 6th May 2022
Why are so many women experiencing delays in their menstrual cycle? And are the blood clots, cancers, spontaneous abortions, and other fertility issues that women are experiencing tied to the mRNA vaccines? In order to answer these questions, we sat down with Dr. Robert Malone—a vaccine expert who holds several patents to the original mRNA platform technology. After Summer, Europe to Target the Unvaccinated - Brownstone Institute - 28th May 2022
"Anyone who imagines that the suspension of Covid-related measures in much of Europe means that those measures, and hence the C-19 vaccination campaign, are things of the past should have a look at the recent pronouncements on the subject of the European Commission, starting with Commission President Ursula von der Leyen’s April 27 statement on the "next pandemic phase". Natural vs vaccine immunity: which is safer or more protective? - The Hart Group - 8th May 2022
"We can conclude that there is not a ‘one size fits all’ risk analysis that can be done in the case of SARS-CoV-2. Those who are at very low risk of adverse effects from COVID-19 (broadly speaking younger, healthier people) would be overall better off developing natural immunity rather than having vaccine-specific immunity. Indeed the recent suggestions in the media that children as young as 12 should receive these vaccinations does not in any way make sense. The long-term harms risk is clearly of greater concern and the cavalier attitude to this possibility is deeply concerning." COVID-19 vaccination and Guillain-Barre syndrome: analyses using the National Immunoglobulin Database - Oxford Academic - Brain - 18th February 2022
"996 GBS cases were recorded in the National Immunoglobulin Database from January to October 2021. A spike of GBS cases above the 2016-2020 average occurred in March-April 2021. 198 GBS cases occurred within 6 weeks of the first-dose COVID-19 vaccination in England (0.618 cases per 100,000 vaccinations, 176 ChAdOx1 nCoV-19 (AstraZeneca), 21 tozinameran (Pfizer), 1 mRNA-1273 (Moderna)). The 6-week excess of GBS (compared to the baseline rate of GBS cases 6-12 weeks after vaccination) occurs with a peak at 24 days post-vaccination; first-doses of ChAdOx1 nCoV-19 accounted for the excess." Does the COVID Jab Kill More People Than It Saves? - UPDATED 22nd May - The Epoch Times
Have you noticed the jabbed and boosted are testing positive for COVID more often than the unvaccinated? Is it pure coincidence or could there be a connection between the number of shots you receive and your risk for coming down with COVID? Here’s what the latest data reveal. The SARS-CoV-2 Spike Protein Activates the Epidermal Growth Factor Receptor-Mediated Signaling - BioRxiv - 10th May 2022
"Results We demonstrate for the first time the activation of EGFR by the Spike 1 protein associated with the phosphorylation of the canonical ERK1/2 and AKT kinases and an increase of survivin expression controlling the survival pathway." Higher COVID-19 Infection Rates Among Vaccinated Children Than Unvaccinated, CDC Data Show - The Epoch Times - 16th May 2022
"According to data released by the Centers for Disease Control and Prevention (CDC), higher COVID-19 case rates have been recorded among fully vaccinated children than unvaccinated in the age group 5-11 since February. On Feb. 12, CDC reported a weekly case rate of 250.02 per 10,000 population in fully vaccinated children aged 5-11, compared to 245.82 for unvaccinated children in the same age group." Updated - 51 Efficacy Studies that Rebuke Vaccine Mandates - Brownstone Institute - 28th October 2021
"As some people have now been vaccinated for more than half a year, evidence is pouring in about Covid vaccine efficacy. The gestalt of the findings implies that the infection explosion globally that we have been experiencing– post double vaccination in e.g. Israel, UK, US etc. –may be due to the vaccinated spreading Covid as much or more than the unvaccinated." Neutralizing Antibodies Against the SARS-CoV Omicron Variant (BA.1) 1 to 18 Weeks After the Second and Third Doses of the BNT162b2 mRNA Vaccine - Jama Network - 13th May 2022
"SARS-CoV-2 neutralizing antibodies are correlated with protection against infection and disease. Our study found a rapid decline in Omicron-specific serum neutralizing antibody titers only a few weeks after the second and third doses of BNT162b2. A limitation of our study is that its cross-sectional design precludes evaluation of antibody decrease rates on an individual level. Nevertheless, the observed decrease in population neutralizing antibody titers corresponds to the decrease in vaccine efficacy against polymerase chain reaction–confirmed Omicron infection in Denmark and symptomatic Omicron infection in the United Kingdom." So you say "Dr. Alexander, you keep raising concern about the vaccines, where is the proof? Is there any evidence? Anything, a study or two besides what you, McCullough, Malone, Tenenbaum, Risch say?
para "Do you have anything Sir? You scientists and clinicians are raising concerns but give us something to work with"...well, ok, see these near 1,000 studies/pieces of evidence, to start... Global COVID Summit Declaration 1V R W Malone MD - Substack - 12th May
A Joint Statement, representing 17,000 Physicians and Medical Scientists to End the National Emergency, Restore Scientific Integrity, and Address Crimes Against Humanity. COVID UPDATE: What is the truth? - Dr Russell Blaylock - SNI - 22nd April 2022
"The COVID-19 pandemic is one of the most manipulated infectious disease events in history, characterized by official lies in an unending stream led by government bureaucracies, medical associations, medical boards, the media, and international agencies. We have witnessed a long list of unprecedented intrusions into medical practice, including attacks on medical experts, destruction of medical careers among doctors refusing to participate in killing their patients and a massive regimentation of health care, led by non-qualified individuals with enormous wealth, power and influence." New Study & Confidential Pfizer Docs. prove COVID "Vaccine Shedding" has been and still is occurring with dangerous consequences - The Expose - 10th May 2022
A new study conducted by scientists at the University of Colorado confirms the vast majority of humanity have had absolutely no choice in the matter of whether they wish to get the Covid-19 injection or not because the vaccinated have been transmitting antibodies generated by the injections through aerosols. The findings should however come as no surprise, because a confidential Pfizer document had already confirmed exposure to the mRNA injections was perfectly possible by skin-to-skin contact and breathing the same air as someone who had been given the Covid-19 jab. Scientific Study confirms Pfizer's COVID Vaccine alters Human DNA - The Expose - 3rd May 2022
A Swedish study has demonstrated and confirmed that the mRNA in the Pfizer/BioNTech Covid injections infiltrates cells and transcribes its message onto human DNA within 6 hours, altering our own DNA. Increased emergency cardiovascular events among under-40 population in Israel during vaccine rollout and third COVID-19 wave - Nature - 28th April 2022
"An increase of over 25% was detected in both call types during January–May 2021, compared with the years 2019–2020. Using Negative Binomial regression models, the weekly emergency call counts were significantly associated with the rates of 1st and 2nd vaccine doses administered to this age group but were not with COVID-19 infection rates." SARS-CoV-2 vaccination can elicit a CD8 T-cell dominant hepatitis - Journal of Hepatology - 20th April 2022Conclusions
"COVID19 vaccination can elicit a distinct T cell-dominant immune-mediated hepatitis with a unique pathomechanism associated with vaccination induced antigen-specific tissue-resident immunity requiring systemic immunosuppression." Prevalence, characteristics, and predictors of Long COVID among diagnosed cases of COVID-19 - MedRxiv - April 2022
Discussion "An observational paradox in our study was that the participants who took two doses of COVID-19 vaccination had higher odds of developing Long COVID." Dear Moms + Dads in the UK - A Warning From American Children - Childrens Health Defense - 25th April 2022
Have you been keeping up with how the vaccination program has hurt children in America? As of last week, the parents and doctors of 10,290 children have filed reports of COVID vaccine injuries in children under 11, some of which are quite serious. Sending love from America's children to the UK! SARS-CoV-2 Kills T-Cells, Just Like HIV - Igor Chudov - Substack - 14th March 2022
"This article was not written by a bunch of random scientists, but instead was written by people from the Wuhan Institute of Virology, including the infamous batwoman Shi Zheng-Li. Just keep this in mind. It was originally submitted in Sep 2021 and revised in January 2022, so it does not involve Omicron." What is SM-102? - Jessica Rose - 21st April 2022
SM-102 is a lipid that you can order online for laboratory use. It is referred to as an ‘ionizable amino lipid’. Immunocompromised SHOULD NOT Be Given Covid Injections, AstraZeneca CEO Said - The Expose - 20th April 2022
"Project Veritas has obtained a recording of an AstraZeneca company-wide zoom call held on 3 December 2020. In the recording CEO Pascal Soriot said that people with immune deficiencies should not receive the “vaccine.” This contradicts guidance from health officials such as the World Health Organisation (“WHO”)." Excess mortality 2020 to now April 2022; where are the honest journalists? Where is the CDC, NIAID, or NIH?
Dr Paul Alexander - Substack - 18th April 2022 Where are the doctors, the specialists, the scientists, the statisticians? Did they spend the bogus grant money already? Oh, sorry, I guess they already spread it out & partied, so can't see the graph. Roltgen et al. " Immune imprinting, breadth of variant recognition, and germinal center response in human SARS-CoV-2 infection and vaccination":
this study is key; shows original antigenic sin (OAS) - Dr Paul Alexander - Substack - 14th April 2022 This is a key study that must not be overlooked as it showed OAS and also, that the spike and mRNA remains for weeks in the germinal centers of the lymph nodes…this is problematic. It dove tails with work by Bruce Patterson’s group that found spike and spike sub-unit 15 months in the blood post infection and a recent study showing spike in blood 60 days post vaccine. Jive Talking Journals : Why the conclusions sometimes don't match the data in scientific papers - The Expose - 13th April 2022
"Biomedical research papers are being published in which the abstract, the discussion section, and even the title contradict the content within the paper. This is unlikely to be happening because the authors don’t understand their own data. It’s more likely that the authors are being pressured by their financial backers and the editorial staff of journals to reach conclusions that advance the prevailing narrative." Dr. Paul Thomas - FACT: Statistically Speaking, Unvaccinated People Are Healthier Then Vaccinated People - Thrivetime Show - 19th January 2022
Re-Awaken America Tour - Amazing statistics from an Amazing Doctor Pfizer Study suggests Covid-19 Vaccine to blame for huge increase in Hepatitis among Children as UK Government launches Urgent Investigation - The Expose - 9th April 2022
"The UK Health Security Agency has announced that it has recently detected higher than usual rates of liver inflammation (hepatitis) among children, but have ruled out the common viruses that cause hepatitis so have therefore launched an urgent investigation. The very first place they should be looking is at the experimental Pfizer Covid-19 injection that has outrageously and unncessarily been offered to children as young as five. Why? Because Pfizer’s own study proves that the mRNA jab accumulates in the liver causing hepatitis." RFK Jr. Discusses Fauci, Vaccines and Big Pharma's Power - Epoch Health - 3rd April 2022
"Hundreds of studies show it destroys health and causes dramatic reductions in IQ, since it accumulates in your brain. In 1997 they started removing it, but essentially replaced one brain-harming substance with another." Syllogistic Reasoning Demystifies Evidence of COVID-19 Vaccine Constituents - International Journal of Vaccine Theory, Practice, and Research - 11th December 2021
"The most plausible conclusion to our extended syllogism would follow, therefore, that developments in nanoparticle adjuvants, such as graphene oxide, have been incorporated into innovative vaccine technology despite the problems they create for human beings. Our deductions trace the chronological and logical progression of technological innovations imposed on people and the various dangers these new tools can pose. Our conclusion, we argue, should engender critical questions that motivate further studies of the effects these injections have on human health, especially over the long-term because nanobots do not decay or evidently go away." "Covid-19 Vaccines" for Children in the UK: A Tale of Establishment Corruption - International Journal of Vaccine Theory, Practice, and Research - 11th March 2022
"How and why has it come to pass that children as young as 12 in the UK are being injected with a novel form of mRNA technology that is unlicensed, has no long-term safety data, and remains in clinical trials until May 2023? This article traces the path by which the unthinkable became an alarming reality between October 2020 and September 2021 and also follows developments since then." Decoding COVID-19 mRNA Vaccine Immunometabolism in Central Nervous System: human brain normal glial and glioma cells by Raman imaging - BioRxiv - 2nd March 2022
"The results obtained for mitochondria, lipid droplets, cytoplasm may suggest that COVID-19 mRNA (Pfizer/BioNT) vaccine reprograms immune responses. The observed alterations in biochemical profiles upon incubation with COVID-19 mRNA in the specific organelles of the glial cells are similar to those we observe for brain cancer vs grade of aggressiveness." The presence of serum anti-SARS-CoV-2 IgA appears to protect primary health care workers from COVID-19 - Wiley - 7th February 2022
"To conclude, serum IgG-dominated responses correlated with T-cell responses to SARS-CoV-2 and PCR-confirmed Covid-19, whereas IgA-dominated responses correlated with not contracting the infection." UK Government data proves the Covid Vaccination Campaign is a disaster; the Fully Vaccinated now account for 92.2% of all Covid-19 Deaths in England - The Expose - 24th March 2022
The latest data published by the UK Health Security Agency confirms the double and triple vaccinated population in England now account for a shocking 92% of all Covid-19 deaths, and 4 in every 5 of those deaths are among the triple jabbed. Episode 259: The Movie That Inspired A Movement - The Highwire - March 2022
How is it that The HighWire’s reporting on Covid has been so far ahead? How did we know so much about the public health players, and the games they would play with lockdowns and vaccines? Because, they’ve done it all before. The HighWire presents "Vaxxed: From Cover-Up to Catastrophe," the movie that exposes one of the biggest public health scandals of all time. They say ‘vaccines don’t cause autism,’ but they never told you this. How does it feel to be vindicated? - Robert W Malone MD. MS - Substack - 13th March 2022
Depressing and demoralizing. And I would do it again in a heartbeat. Long-Term Persistence of IgG Antibodies in recovered COVID-19 individuals at 18 months and the impact of two-dose BNT162b2 (Pfizer-BioNTech) mRNA vaccination on the antibody response - MedRxiv - 18th January 2022
"Our study findings demonstrate that while double dose vaccination boosted the IgG titers in recovered individuals 161 times, this “boost” was relatively short-lived. The unvaccinated recovered individuals, in contrast, continued to show a steady decline but detectable antibody levels. Further studies are required to re-evaluate the timing and dose regimen of vaccines for an adequate immune response in recovered individuals." Dr John Campbell has been red-pilled - Steve Kirsch's Newsletter - 12th March 2022
This is an important post. This may be one of the most important posts I’ve made so far. It shows that the tide is turning our way: a former advocate of the vaccine, trusted by millions of people, has now realized he’s been deceived and he’s not happy about it at all. Dr John Campbell - The Pfizer documents - youTube - 9th March 2022
Adverse event reports 01 December 2020 through 28 February 2021 Cumulatively, through 28 February 2021, a total of 42,086 case reports (25,379 medically confirmed and 16,707 non-medically confirmed) containing 158,893 events. Dr Naomi Wolf and Dr Robert W. Malone on Pfizer Documents "A huge list of adverse events of interest." - Warroom.org - 10th March 2022
The Pfizer drug company tried to keep the documents related to their emergency Covid-19 vaccine secret for 75 years, but a judge ordered the documents released immediately. Now Dr. Robert Malone, public activist Naomi Wolf and others are poring through the documents (available online here). The public is asked to participate in examining the documents in order to get information out as quickly as possible about how we were misled about dangers and shortcuts related to the vaccine. Some Insurance company data from Germany - Jessica Rose - 4th March 2022
"BKK Provita is a German insurer. Recently, a board member revealed data indicating that adverse events associated with the COVID-19 injectable products are in great excess to the AEs reported by the Paul Ehrlich Institute (German Federal Agency and Medical Regulatory Body) confirming a great divide between what’s actually happening to people with regard to damage, and what’s being reported." Peer review example: "Effectiveness of the BNT162b2 vaccine among children - Robert W Malone MD MS - Substack - 1st March 2022
`'The goal with this essay is to give you a peek into what an independent peer review of an academic manuscript might look like. I go through a similar process when I review grants and contracts, but in those cases I have the benefit of a “biosketch” for the authors, as well as a detailed budget, clear statement of purpose, detailed description of methods etc." Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line - MDPI - 25th February 2022
"Our results indicate a fast up-take of BNT162b2 into human liver cell line Huh7, leading to changes in LINE-1 expression and distribution. We also show that BNT162b2 mRNA is reverse transcribed intracellularly into DNA in as fast as 6 h upon BNT162b2 exposure." 'Scientific fraud': Drs. Robert Malone, Ryan Cole react to CDC hiding data - WND - 22nd February 2022
'These are the people that are entrusted to tell us the truth' GIG HARBOR, Washington – Urging CDC scientists to speak out, Dr. Robert Malone and Dr. Ryan Cole reacted Monday to the news reported by the New York Times that agency officials admit they have withheld COVID data broken down by age, race and vaccination status because the American people might misinterpret it. Immunocompromised children and young people are at no increased risk of severe COVID-19
- PubMed - January 2022 "Conclusions: This study shows SARS-CoV-2 infections have occurred in immunocompromised children and young people with no increased risk of severe disease. No children died." Open Letter with Notice of Legal Obligations and Potential Liabilities to anyone Advocating or Administering COVID-19 Vaccines to Children - UK Medical Freedom Alliance - 11th February 2022
"This letter is addressed to Public Officers in both their personal and professional capacities. It notifies them of their legal duties to any children in their care, in their capacity as a teacher, healthcare professional, public office holder, carer or parent, and the potential legal position should they breach those duties. It refers to any and all harms caused by decisions that they have made or complied with pertaining to COVID-19 vaccinations for children." Study finds previous COVID-19 infection, but not vaccination, improves performance of antibodies and potentially provides longer-term protection -
European Society of Clinical Microbiology and Infectious Diseases - EurekAlert - 10th February 2022 Researchers also found that previously-infected patients with obesity, contrary to expectations, had a higher and more sustained immune response "New research to be presented at this year’s European Congress of Clinical Microbiology & Infectious Diseases (ECCMID 2022, Lisbon, 23-26 April) shows that, although over time the number of SARS-CoV-2 antibodies falls in both previously infected and vaccinated patients, the performance of antibodies improves only after previous infection (and not vaccination). This difference could explain why previously infected patients appear to be better protected against a new infection than those who have only been vaccinated." Covid-19 Vaccines caused 1048% increase in Diseases of the Nervous System among the Military in 2021 according to Official U.S. Government Database - The Expose - 10th February 2022
"The US Military Medical Database shows a huge rise in serious diseases and injuries in 2021 compared to the previous five-year-average, and with up to 93% of the military getting the Covid-19 injection, several doctors believe the jab is to blame." Immune imprinting, breadth of variant recognition and germinal center response in human SARS-CoV-2 infection and vaccination - Science Direct - 25th January 2022
"We analyzed human lymph nodes after infection or mRNA vaccination for correlates of serological differences. Antibody breadth against viral variants is less after infection compared to all vaccines evaluated, but improves over several months. Viral variant infection elicits variant-specific antibodies, but prior mRNA vaccination imprints serological responses toward Wuhan-Hu-1 rather than variant antigens. In contrast to disrupted germinal centers (GCs) in lymph nodes during infection, mRNA vaccination stimulates robust GCs containing vaccine mRNA and spike antigen up to 8 weeks post-vaccination in some cases. SARS-CoV-2 antibody specificity, breadth and maturation are affected by imprinting from exposure history, and distinct histological and antigenic contexts in infection compared to vaccination." Long Funeral Homes, Short Life Insurers? Ex-Blackrock Fund Manager Discovers Disturbing Trends in Mortality - ZeroHedge - 5th February 2022
"Four weeks ago, OneAmerica insurance company CEO Scott Davison revealed that they had witnessed 'the highest death rates in the history of this business - not just at OneAmerica' with a jump of '40% over what they were pre-pandemic.' Interestingly, Davison noted that the majority of deaths are not classified as due to Covid-19." Myocarditis Cases Reported After mRNA-Based COVID-19 Vaccination in the US From December 2020 to August 2021 - Jama - 25th January 2022
Findings In this descriptive study of 1626 cases of myocarditis in a national passive reporting system, the crude reporting rates within 7 days after vaccination exceeded the expected rates across multiple age and sex strata. The rates of myocarditis cases were highest after the second vaccination dose in adolescent males aged 12 to 15 years (70.7 per million doses of the BNT162b2 vaccine), in adolescent males aged 16 to 17 years (105.9 per million doses of the BNT162b2 vaccine), and in young men aged 18 to 24 years (52.4 and 56.3 per million doses of the BNT162b2 vaccine and the mRNA-1273 vaccine, respectively). Open Letter to the MHRA Regarding Child Death Data - HART - 20th January 2022
Signals that Covid-19 Vaccines may have caused death in children and young adults "We write to demand an immediate, urgent investigation to determine whether the Covid-19 vaccines are the cause of significant numbers of deaths seen recently in male children and young adults." Urgent! Stop FDA Approval of Pfizer Shots for Kids 6 Months to 4 Years
Childrens Health Defense - 3rd February 2022 The clinical trial failed in this age group. We have 14 days to stop the U.S. Food and Drug Administration from committing a crime against humanity. Dispelling the Myth of "A Pandemic Of The Unvaccinated" - Canadian Covid Care Alliance - 1st February 2022
It's time to stop the mandates, the passports, the inoculation of children, all of it.In our latest video “Dispelling the Myth of A Pandemic of the Unvaccinated” we reveal shocking truths using Ontario’s own public health data. A proper analysis of this data shows that the vaccine mandates have completely failed to control COVID-19 case growth and that the fully vaccinated are contracting COVID-19 at higher rates than the unvaccinated. Even more, it shows that hospital capacity is being stretched by the vaccinated and not the unvaccinated. And to top it all off it provides definitive proof that the pandemic has been over since early March 2021 when the death counts due to COVID-19 became negligible. Rapid emergence of SARS-CoV-2 Omicron variant is associated with an infection advantage over Delta in vaccinated persons - MedRxiv - 22nd January 2022
"In conclusion, escape from vaccine-induced immunity likely contributed to the rapid rise in Omicron infections." Innate Immune Suppression by SARS-CoV-2 mRNA Vaccinations: The role of G-quadruplexes, exosomes and microRNAs - Authorea - 21st January 2022
"In this paper, we present the evidence that vaccination, unlike natural infection, induces a profound impairment in type I interferon signaling, which has diverse adverse consequences to human health. We explain the mechanism by which immune cells release into the circulation large quantities of exosomes containing spike protein along with critical microRNAs that induce a signaling response in recipient cells at distant sites. We also identify potential profound disturbances in regulatory control of protein synthesis and cancer surveillance. These disturbances are shown to have a potentially direct causal link to neurodegenerative disease, myocarditis, immune thrombocytopenia, Bell’s palsy, liver disease, impaired adaptive immunity, increased tumorigenesis, and DNA damage." Prior COVID infection more protective than vaccination during Delta surge - U.S. study - reuters.com - 19th January
"People who had previously been infected with COVID-19 were better protected against the Delta variant than those who were vaccinated alone, suggesting that natural immunity was a more potent shield than vaccines against that variant, California and New York health officials reported on Wednesday.Protection against Delta was highest, however, among people who were both vaccinated and had survived a previous COVID infection, and lowest among those who had never been infected or vaccinated, the study found." SARS-CoV-2 Vaccines and Neurodegenerative Disease - Stephanie Seneff and GreenMedInfo - 11th January 2022
"There are many reasons to be wary of the COVID-19 vaccines, which have been rushed to market with grossly inadequate evaluation and aggressively promoted to an uninformed public, with the potential for huge, irreversible, negative consequences. One potential consequence is to exhaust the finite supply of progenitor B cells in the bone marrow early in life, causing an inability to mount new antibodies to infectious agents. An even more worrisome possibility is that these vaccines, both the mRNA vaccines and the DNA vector vaccines, may be a pathway to crippling disease sometime in the future." Cross-reactive memory T cells associate with protection against SARS-CoV-2 infection in Covid-19 contacts - Nature - 10th January 2022
"We observe higher frequencies of cross-reactive (p = 0.0139), and nucleocapsid-specific (p = 0.0355) IL-2-secreting memory T cells in contacts who remained PCR-negative despite exposure (n = 26), when compared with those who convert to PCR-positive (n = 26); no significant difference in the frequency of responses to spike is observed, hinting at a limited protective function of spike-cross-reactive T cells. Our results are thus consistent with pre-existing non-spike cross-reactive memory T cells protecting SARS-CoV-2-naïve contacts from infection, thereby supporting the inclusion of non-spike antigens in second-generation vaccines." Dr Robert Malone and Joe Rogan - Full-Length Interview - Revealing the Truth About COVID-19 & Medical Fraud - Rumble - 3rd January 2022
Dr. Robert Malone Full-Length Interview w/ Joe Rogan | Revealing the Truth About COVID-19 & Medical Fraud Waning of SARS-CoV-2 booster viral-load reduction effectiveness - medRXiv - 27th December 2021
"The rate and magnitude of this post-booster decline in viral-load reduction effectiveness mirror those observed post the second vaccine. These results suggest rapid waning of the booster’s effectiveness in reducing infectiousness, possibly affecting community-level spread of the virus." Analysis Overview: Covid-19 Genetic Vaccine Safety in Children
Robert W Malone MD - December 2021 “Even as experts expressed concern about a marked jump in hospitalizations — an increase more than double that among adults — doctors and researchers said they were not seeing evidence that Omicron was more threatening to children. In fact, preliminary data suggests that compared with the Delta variant, Omicron appears to be causing milder illness in children, similar to early findings for adults." Status of the SARS-CoV-2 variant Omicron in Denmark - SSI-files -18th December 2021
Table 4 - Vaccination status for individuals >12 years infected with Omicron from 22 November to 15 December 2021 Booster vaccinated - 1,460 - 10.3% Fully vaccinated - 11,252 - 79.3% Not vaccinated - 1,205 cases - 8.5% Received first dose - 271 - 1.9% COVID vaccination and age-stratified all-cause mortality risk
ResearchGate - October 2021 "Comparing our age-stratified VFRs with published age-stratified coronavirus infection fatality rates (IFR) suggests the risks of COVID vaccines and boosters outweigh the benefits in children, young adults and older adults with low occupational risk or previous coronavirus exposure. We discuss implications for public health policies related to boosters, school and workplace mandates, and the urgent need to identify, develop and disseminate diagnostics and treatments for life-altering vaccine injuries." More Harm than Good Canadian Covid Care Alliance - 16th December 2021
The Pfizer 6 month data shows that Pfizer's COVID-19 innoculations cause more illness than they prevent. Plus, an overview of the Pfizer trial flaws in both design and execution. Hospital admission 50-70% less likely with omicron than delta, but transmission a major concern - BMJ - 24th December 2021
"Someone infected with the omicron variant of SARS-CoV-2 is estimated to be between 31% and 45% less likely to attend emergency care than if they had been infected with the delta variant and 50-70% less likely to be admitted to hospital, analysis by the UK Health Security Agency has shown." Risk of Hospitalization, severe disease, and mortality due to COVID-19 and PIMS-TS in children with SARS-CoV-2 infection in Germany medRxiv - 30th November 2021
"Conclusion Overall, the SARS-CoV-2-associated burden of a severe disease course or death in children and adolescents is low. This seems particularly the case for 5-11-year-old children without comorbidities. By contrast, PIMS-TS plays a major role in overall disease burden among all pediatric age groups." The BNT162b2 mRNA vaccine against SARS-CoV-2 reprograms both adaptive and innate immune responses - medRxiv
"Interestingly, however, the BNT162b2 vaccine also modulated the production of inflammatory cytokines by innate immune cells upon stimulation with both specific (SARS-CoV-2) and non-specific (viral, fungal and bacterial) stimuli. The response of innate immune cells to TLR4 and TLR7/8 ligands was lower after BNT162b2 vaccination, while fungi-induced cytokine responses were stronger. In conclusion, the mRNA BNT162b2 vaccine induces complex functional reprogramming of innate immune responses, which should be considered in the development and use of this new class of vaccines." DID YOU KNOW? - The Unity Project - Dr Robert Malone
"According to CDC, the death rate for children under 19 from COVID-19 is statistically 0% - Therefore healthy children do not need to be vaccinated." Covid-19 Mortality Risk Correlates Inversely with Vitamin D3 Status, and a Mortality Rate Close to Zero Could Theoretically Be Achieved at 50 ng/mL 25(OH)D3: Results of a Systematic Review and Meta-Analysis
MDPI - Nutrients - 14th October 2021 "Conclusions: The datasets provide strong evidence that low D3 is a predictor rather than just a side effect of the infection. Despite ongoing vaccinations, we recommend raising serum 25(OH)D levels to above 50 ng/mL to prevent or mitigate new outbreaks due to escape mutations or decreasing antibody activity." Evaluating the number of unvaccinated people needed to exclude to prevent SARS-CoV-2 transmissions - MedRxiv - 8th December 2021
"Conclusions: Vaccines are beneficial, but the high NNEs suggest that excluding unvaccinated people has negligible benefits for reducing transmissions in many jurisdictions across the globe. This is because unvaccinated people are likely not at significant risk — in absolute terms — of transmitting SARS-CoV-2 to others in most types of settings since current baseline transmission risks are negligible. Consideration of the harms of exclusion is urgently needed, including staffing shortages from losing unvaccinated healthcare workers, unemployment/unemployability, financial hardship for unvaccinated people, and the creation of a class of citizens who are not allowed to fully participate in many areas of society." Mechanisms of SARS-Cov-2 Evolution Revealing Vacine-Resistant Mutations in Europe and America - American Chemical Society - 7th December 2021
"By tracking the evolutionary trajectories of vaccine-resistant mutations in more than 2.2 million SARS-CoV-2 genomes, we reveal that the occurrence and frequency of vaccine-resistant mutations correlate strongly with the vaccination rates in Europe and America. We anticipate that as a complementary transmission pathway, vaccine-breakthrough or antibody-resistant mutations, like those in Omicron, will become a dominating mechanism of SARS-CoV-2 evolution when most of the world’s population is either vaccinated or infected. Our study sheds light on SARS-CoV-2 evolution and transmission and enables the design of the next-generation mutation-proof vaccines and antibody drugs." ICAN Eviscerates CDC in Formal Exchange Regarding Natural Immunity. 23rd October 2021
When the CDC chose to lift restrictions on the vaccinated, ICAN went to work. Through its attorneys, it formally demanded that the CDC also (at the least) lift restrictions on the naturally immune. It provided the CDC with over 60 studies reflecting that natural immunity is more durable and robust than vaccine immunity. The CDC’s response is shameful. It fails to address any of these studies, collectively involving millions of people, and instead cites a single irrelevant study of a few hundred people that does not even involve comparing vaccine versus natural immunity! Community transmission and viral load kinetics of the SARS-CoV-2 delta (B.1.617.2) variant in vaccinated and unvaccinated individuals in the UK: a prospective, longitudinal, cohort study
The Lancet - 29th October 2021 "Vaccination reduces the risk of delta variant infection and accelerates viral clearance. Nonetheless, fully vaccinated individuals with breakthrough infections have peak viral load similar to unvaccinated cases and can efficiently transmit infection in household settings, including to fully vaccinated contacts. Host–virus interactions early in infection may shape the entire viral trajectory." Severity of SARS-CoV-2 Reinfections as Compared with Primary Infections - The New England Journal of Medicine - 24th November 2021
"Reinfections had 90% lower odds of resulting in hospitalization or death than primary infections. Four reinfections were severe enough to lead to acute care hospitalization. None led to hospitalization in an ICU, and none ended in death. Reinfections were rare and were generally mild, perhaps because of the primed immune system after primary infection." Abstract 10712: Mrna COVID Vaccines Dramatically Increase Endothelial Inflammatory Markers and ACS Risk as Measured by the PULS Cardiac Test: a Warning - Circulation - aha journals - 8th November 2021
"We conclude that the mRNA vacs dramatically increase inflammation on the endothelium and T cell infiltration of cardiac muscle and may account for the observations of increased thrombosis, cardiomyopathy, and other vascular events following vaccination." FDA Produces the First 91+ pages of Documents from Pfizer's COVID-19 Vaccine File
Only 54 years, 11 months to go... - Aaron Siri 20th November 2021 "Two months and one day after it was sued, and close to 3 months since it licensed Pfizer’s Covid-19 vaccine, the FDA released the first round of documents it reviewed before licensing this product. The production consisted of 91 pdf pages, one xpt file, and one txt file. You can download them here." A majority of uninfected adults show pre-existing antibody reactivity against SARS-CoV-2 - JCI insight - 2021
Preexisting cross-reactivity to SARS-CoV-2 occurs in the absence of prior viral exposure. However, this has been difficult to quantify at the population level due to a lack of reliably defined seroreactivity thresholds. Using an orthogonal antibody testing approach, we estimated that about 0.6% of nontriaged adults from the greater Vancouver, Canada, area between May 17 and June 19, 2020, showed clear evidence of a prior SARS-CoV-2 infection, after adjusting for false-positive and false-negative test results. Using a highly sensitive multiplex assay and positive/negative thresholds established in infants in whom maternal antibodies have waned, we determined that more than 90% of uninfected adults showed antibody reactivity against the spike protein, receptor-binding domain (RBD), N-terminal domain (NTD), or the nucleocapsid (N) protein from SARS-CoV-2. This seroreactivity was evenly distributed across age and sex, correlated with circulating coronaviruses’ reactivity, and was partially outcompeted by soluble circulating coronaviruses’ spike. Using a custom SARS-CoV-2 peptide mapping array, we found that this antibody reactivity broadly mapped to spike and to conserved nonstructural viral proteins. We conclude that most adults display preexisting antibody cross-reactivity against SARS-CoV-2, which further supports investigation of how this may impact the clinical severity of COVID-19 or SARS-CoV-2 vaccine responses. Why have deaths among Female Children increased by 57% against the 5-year-average since they were first offered the Covid-19 Vaccine? - The Expose - 17th November 2021
An analysis of official data available from the Office for National Statistics shows that deaths among female children have increased by 57% against the five-year-average since they were first offered the Covid-19 vaccine, after previously being in line with the expected average prior to Chris Whitty advising the UK Government to offer the experimental injection to children. Sins of Science - Episode 241 - The Highwire.com
Big Bird Gets Covid Shot; Aaron Rodgers Throws Covid Touchdown; Homeschooling 101; Disruption of our DNA & Other Sins of Science SARS-CoV-2 vaccine protection and deaths among US veterans during 2021 - Science - 4th November 2021Abstract
We report SARS-CoV-2 vaccine effectiveness against infection (VE-I) and death (VE-D) by vaccine type (n = 780,225) in the Veterans Health Administration, covering 2.7% of the U.S. population. From February to October 2021, VE-I declined from 87.9% to 48.1%, and the decline was greatest for the Janssen vaccine resulting in a VE-I of 13.1%. Critical Appraisal of VAERS Pharmacovigilance: Is the U.S. Vaccine Adverse Events Reporting System (VAERS) a Functioning Pharmacovigilance System? - Jessica Rose PhD, MSc, Bsc - IPAK PHPI - October 2021
"This appraisal assesses three issues that respond to the question of VAERS pharmacovigilance by analyzing VAERS data: 1. deleted reports, 2. delayed entry of reports and 3. recoding of Medical Dictionary for Regulatory Activities (MedDRA) terms from severe to mild. The most recently updated publicly available VAERS dataset was found to have N=1516 (0.4%) VAERS IDs removed (“missing”)." Facts Matter(Nov.8): New Study Finds Efficacy of 2 Vaccines Drops Below 50%. One of them to Only 13% - The Epoch Times - 8th November 2021
a new study found that the effectiveness of all three of the vaccines available in America decreases dramatically over time—with two of the vaccines being less than 50 percent effective after six months. Comprehensive investigations revealed consistent pathophysiological alterations after vaccination with COVID-19 vaccines - PubMed Central 26th October 2021
"Large-scale COVID-19 vaccinations are currently underway in many countries in response to the COVID-19 pandemic. Here, we report, besides generation of neutralizing antibodies, consistent alterations in hemoglobin A1c, serum sodium and potassium levels, coagulation profiles, and renal functions in healthy volunteers after vaccination with an inactivated SARS-CoV-2 vaccine. Similar changes had also been reported in COVID-19 patients, suggesting that vaccination mimicked an infection." Delta Driven By Vaxxed in New Study The Highwire - 5th November 2021
We were told it was a pandemic of the unvaccinated. Now, new science has revealed a shocking truth. Spontaneous Abortions and Policies on COVID-19 mRNA Vaccine Use During Pregnancy - Rapid Communication - Brock & Thornley - November 2021
Abstract "The use of mRNA vaccines in pregnancy is now generally considered safe for protection against COVID-19 in countries such as New Zealand, USA, and Australia. However, the influential CDC-sponsored article by Shimabukuro et al. (2021) used to support this idea, on closer inspection, provides little assurance, particularly for those exposed in early pregnancy. The study presents falsely reassuring statistics related to the risk of spontaneous abortion in early pregnancy, since the majority of women in the calculation were exposed to the mRNA product after the outcome period was defined (20 weeks gestation)." COVID-19: Researcher blows the whistle on data integrity issues in Pfizer's vaccine trial - BMJ - 2nd November 2021
Revelations of poor practices at a contract research company helping to carry out Pfizer’s pivotal covid-19 vaccine trial raise questions about data integrity and regulatory oversight. Paul D Thacker reports Dr Richard Fleming PHD: Pfizer "Vaccine" attacks Human Blood Creating Clots under Microscope - Bitchute - 31st October 2021
Dr.Richard Fleming, PhD: Pfizer "vaccine" attacks human blood creating clots under microscope The Persistence of Neutralising Antibodies up to 11 months after SARS-CoV-2 infection in the Southern Region of New Zealand - MedRxiv - 26th October 2021
During the first wave of SARS-CoV-2 infection in New Zealand a cohort of 78 PCR-confirmed COVID-19 cases was recruited in the Southern District Health Board region. Here we report on this unique cohort nearly 1-year after infection. There was no known community transmission in the region over the study period due to New Zealands elimination status at the time, nor had any participants received a COVID-19 vaccine. In the absence of re exposure, antibody reactivity to the viral spike protein, as well as neutralising antibodies to both the ancestral strain and the delta variant remained relatively stable between 8 and 11 months post-infection. This suggests long-lived antibody responses can be generated from a single natural infection event. However, given the risks of serious disease associated with SARS-CoV-2 infection, vaccination is still strongly recommended. Hawaii Attorney Files Class Action Lawsuit, Says Vax has killed 45,000 People!!! - August 2021
Michael Green has filed a class action lawsuit initially representing 1,200 first responders against the Governor’s vaccine mandates with thousands more expected to join. Honolulu Fire Captain Kaimi Pelekai gives an emotional testimony about losing his job because he doesn’t want to put this experimental vaccine in his body after spending the last year taking care of COVID-19 patients. Attorney Sean Williams says that there are already effective treatments like hydroxychloroquine and ivermectin. And, according to the CDC, it is unnecessary to test asymptomatic people because they do not spread the virus. Illness Characteristics of COVID-19 in children infected with the SARS-CoV-2 Delta variant - MedRxiv - 6th October 2021
"Interpretation: COVID-19 in UK school-aged children due to SARS-CoV-2 Delta strain B.1.617.2 resembles illness due to the Alpha variant B.1.1.7., with short duration and similar symptom burden." mRNA vaccine-induced T cells respond identically to SARS-CoV-2 variants of concern but differ in longevity and homing properties depending on prior infection status - Immunology and Inflammation, Microbiology and Infectious Disease - elifesciences - 12th October 2021
"Spike-specific T cells from convalescent vaccinees differed strikingly from those of infection-naive vaccinees, with phenotypic features suggesting superior long-term persistence and ability to home to the respiratory tract including the nasopharynx. " Anti-Sars-CoV-2 receptor binding domain antibody evolution after mRNA vaccination - Nature 7th October 2021
"Here we examine memory B cell evolution 5 months after vaccination with either Moderna(mRNA-1273) or Pfizer-BioNTech(BNT162b2) mRNA vaccines in a cohort of SARS-CoV-2 naive individuals. Between prime and boost, memory B cells produce antibodies that evolve increased neutralising activity, but there is no further increase in potency or breadth thereafter. Instead, memory B cells that emerge 5 months after vaccination of naive individuals express antibodies that are similar to those that dominate the initial response. While individual memory antibodies selected over time by natural infection have greater potency and breadth than antibodies elicited by vaccination, the overall neutralizing potency of plasma is greater following vaccination. These results suggest that boosting vaccinated individuals with currently availabe mRNA vaccines will increase plasma neutralizing activity but may not produce antibodies with equivalent breadth to those obtained by vaccinating convalescent individuals". Dr Ryan Cole - America's Frontline Doctors - Autopsies Summit
8th August 2021 AFLDS.org presents SUMMIT SESSIONS: The Science, part of a series of presentations delivering accurate scientific facts, the latest medical research, and sensible health policy solutions, featuring Dr. Ryan Cole. Durability of immune responses to the BNT162b2 mRNA vaccine - BioRxiv 30th September 2021
"Our data demonstrate a substantial waning of antibody responses and T cell immunity to SARS-CoV-2 and its variants, at 6 months following the second immunization with the BNT162b2 vaccine. Notably, a significant proportion of vaccinees have neutralizing titers below the detection limit, and suggest a 3rd booster immunization might be warranted to enhance the antibody titers and T cell responses." Senator Rand Paul Asserts Natural Immunity Is As Good As COVID-19 Vaccine - September 30 2021
Senator Rand Paul (R-KY) challenges HHS Secretary Xavier Becerra on the Biden administration's vaccine mandates and says the science is against them when it comes to naturally acquired immunity for those who have already had COVID-19 infections. Covid-19: Do many people have pre-existing immunity? - the BMJ - September 2020
It seemed a truth universally acknowledged that the human population had no pre-existing immunity to SARS-CoV-2, but is that actually the case? Peter Doshi explores the emerging research on immunological responses 
Why are we vaccinating children against Covid-19?
ScienceDirect 10th August 2021 Highlights Bulk of COVID-19 per capita deaths occur in elderly with high comorbidities. Per capita COVID-19 deaths are negligible in children. Clinical trials for these inoculations were very short-term. Clinical trials did not address long-term effects most relevant to children. High post-inoculation deaths reported in VAERS (very short-term). The Highwire.com - The VAERS scandal - Episode 233
Artemisia annua hot-water extracts show potent activity in vitro against Covid-19 variants including delta
biorxiv.org - 8th September 2021 "Results suggest that oral consumtion of A. annua hot-water extracts (tea infusions), could provide a cost-effective therapy to help stave off the rapid global spread of these variants" Having SARS-CoV-2 once confers much greater immunity than a vaccine - but no infection parties, please - SCIENCE 26th August 2021
Comparing SARS-CoV-2 natural immunity to vaccine induced immunity: reinfection versus breakthrough infections - medRxiv 24th August 2021
"Conclusions This study demonstrated that natural immunity confers longer lasting and stronger protection against infection, symptomatic disease and hospitalisation caused by the Delta variant of SARS-CoV-2, compared to the BNT162b2 two dose vaccine- induced immunity" Necessity of COVID-19 vaccination in previously infected individuals
medRxiv June 2021 Conclusions Individuals who have had SARS-CoV-2 infection are unlikely to benefit from COVID-19 vaccination, and vaccines can be safely priorized to those who have not been infected before." Antibody-dependent enhancement and SARS-CoV-2 vaccines and therapies - Naure microbiology - 9th September 2020
"Data from the study of SARS-CoV-2 and other respiratory viruses suggest that anti-SARS-CoV-2 antibodies could exacerbate COVID-19 through antibody-dependent enhancement (ADE)" thehighwire.com - Del Bigtree
Episode 226 - Ahead of the Curve The Covid Narrative is Unraveling; The HighWire Highlight’s Shocking COVID Accuracy; Dr. Barke Opposes Masking Kids Again; Hope for the Covid Vaccine Injured; Where is this all going?Guests: Jeffrey Barke, MD; Angelia Deselle; Shawn Skelton thehighwire.com - Del Bigtree
Episode 225 - The Covid Blame Game Rand Paul Roasts Tony Fauci; Del Dives into the Data; Dr. McCullough on the Vaccine, Delta Variant, and much more; An all-new HighWire Hero! Guest: Dr. Peter McCullough, MD, MPH Selectively expressing SARS-CoV-2 Spike protein S! subunit in cardiomyocytes induces cardiac hypertrophy in mice - June 2021
To investigate the possible pathological role of CoV-2-S1 in the heart, we generated a construct that expresses membrane-localized CoV-2-S1 (S1-TM). AAV9-mediated, selective expression of the S1-TM in CMs caused heart dysfunction, induced hypertrophic remodeling, and elicited cardiac inflammation. Since CoV-2-S does not interact with murine ACE2, our study presents a novel ACE2-independent pathological role of CoV-2-S, and suggests that the circulating CoV-2-S1 is a TLR4-recognizable alarmin that may harm the CMs by triggering their innate immune responses. Covid-19 Vaccines and Children:
A Scientist's Guide for Parents Dr Byram W. Bridle, PhD Associate Professor of Viral Immunology June 15, 2021 Canadian Covid Care Alliance CCCA The TRUTH About COVID-19, Lockdowns, and mRNA Vaccines
Steve Deace Show - Jun 22 2021 Pathologist Dr. Ryan Cole joins the show to discuss what we know about the mRNA COVID vaccines... The Highwire.com - Del Bigtree
Risky Business - Dr Jim Meehan Facebook Censorship Exposed - Lab Origin - Now Mainstream Turns a Blind Eye. The Importance of Absolute Risk. Dr. McCullough on Natural Immunity Children's Health Defense - The Defender
June 2021 Tucker Carlson: 'Healthy Young People More Likely to Be Harmed by Vaccine, Than by Covid' Fox News commentator, Tucker Carlson, said pushing COVID vaccines on young people is “reckless” because we don’t know the long-term effects. “Anyone who claims to know is lying.” Evolution of antibody immunity to SARS-COV-2
www.nature.com/articles/s41586-021-03207-w Antibody evolution what vaccine can do that? - this research shows that the Immune system keeps working on perfecting the immune response for months (perhaps years) after the infection has been cleared. The antigen is held in immune complexes and used as a template to make even more efficient antibody and memory cells - preparing for the next time it meets the disease (antigen). Correlation Between 3790 Quantitative Polymerase Chain Reaction - Positives samples and Positive Cell Cultures, Including 1941 Severe Acute Respiratory Syndrome Coronavirus 2 Isolates - Clinical Infectious Diseases
June 2021 In this study 56% of Positive PCR test cases were not infectious at the high Ct values we are using to test the public worldwide. Autism Reaches 6% in British Schools it's just one of those things! by John Stone US FDA bans dietary supplement NAC June 2020 Dietary Supplement NAC - Research papers and new research on NAC suggests it can help to reduce adverse outcomes in COVID-19 patients. After sending warning letters to several manufacturers, the FDA invoked the Drug Exclusion Provision in U.S. code Title 21 to ban the sale of n-acetylcysteine (NAC) According to one attorney, this is legally questionable and, according to counsel for the counsel for Responsible Nutrition (CRN), for several reasons it is "legally invalid". The FDA used this same tactic on supplements infringing on the financial gain of pharmaceutical companies and may have done the same with NAC since the supplement may effectively reduce the incidence of severe COVID-19. NAC has multiple health benefits as it reduces oxidative stress in the body, which plays asignificant role in the development of Alzheimer's and Parkinson's disease, cancer, stroke, diabetes and liver disease Electronic Support for Public Health - Vaccine Adverse Event Reporting System(ESP:VAERS) Fewer than 1% of Vaccine Adverse Events are reported to VAERS Preliminary data were collected from June 2006 through October 2009 on 715,000 patients, and 1.4 million doses (of 45 different vaccines) were given to 376,452 individuals. Of these doses, 35,570 possible reactions (2.6 percent of vaccinations) were identified. This is an average of 890 possible events, an average of 1.3 events per clinician, per month. These data were presented at the 2009 AMIA conference. Don't use Antibody Tests Post Vaccine to Determine Immunity - by Dr J Mercola Interview Alex Pierson with Dr Bridle about new peer reviewed study on Covid-19 vaccines suggests why heart inflammation, blood clots and other side effects occur. May 2021 Research - Spike protein crosses the blood brain barrier Neurobiol Dis. - Dec 2020 A Single Immunisation with Spike-Functionalized Ferritin Vaccines Elicits Neutralizing Antibody Responses against SARS-CoV-2 in Mice PMC - Jan 21 The development of a safe and effective SARS-CoV-2 vaccine is a public health priority. We designed subunit vaccine candidates using self-assembling ferritin nanoparticles displaying one of two multimerized SARS-CoV-2 spikes: full-length ectodomain (S-Fer) or a C-terminal 70 amino-acid deletion (SΔC-Fer). Ferritin is an attractive nanoparticle platform for production of vaccines, and ferritin-based vaccines have been investigated in humans in two separate clinical trials. Multisystem inflammatory Syndrom and Covid-19 Vaccination CDC - July 2021 US Case Reports of Cerebral Venous Sinus Thrombosis with Thrombocytopenia after Covid-19 vaccination. March to April 2021 Ischaemic stroke as a presenting feature of Covid-19 vaccine- induced thrombotic thrombocytopaenia. Journal of Neurology, Neurosurgery & Psychiatry First reported cases of clots in large arteries causing stroke following Covid-19 vaccination - BMJ Three cases of ischaemic stroke report in young adutls following administration of the AstraZeneca vaccine. Covid-19 vaccine weekly safety report 27/5/2021 from Australian Govt. COVID PLAN B Fact-checking Covid vaccine experts. by Simon Thornley Robust T cell immunity in convalescent individuals with asymptomatic or mild Covid-19 Don't let anyone tell you that you need a vaccine to be protected. That is misinformation. Good News: Mild Covid-19 induces lasting antibody protection by Washington University School of Medicine Covid vaccines for children should not get emergency use authorization May 2021- thebmj opinion 18 CT Teens Report Heart Problems After Coronavirus Vaccine May 2021 The Many Ways in Which COVID Vaccines May Harm Your Health by Dr J Mercola The Study the CDC would not do. Comparison of the Health results of Vaccinated versus Unvaccinated - New Research at last Relative Incidence of Office Visits and Cumulative Rates of Billed Diagnoses Along the Axis of Vaccination. James Lyons-Weiler and Paul Thomas. Environmental Research and Public Health - November 2020. We performed a retrospective analysis spanning ten years of pediatric practice focused on patients with variable vaccination born into a practice, presenting a unique opportunity to study the effects of variable vaccination on outcomes. The average total incidence of billed office visits per outcome related to the outcomes were compared across groups (Relative Incidence of Office Visit (RIOV)). RIOV is shown to be more powerful than odds ratio of diagnoses. Full cohort, cumulative incidence analyses, matched for days of care, and matched for family history analyses were conducted across quantiles of vaccine uptake. Increased office visits related to many diagnoses were robust to days-of-care-matched analyses, family history, gender block, age block, and false discovery risk. Many outcomes had high RIOV odds ratios after matching for days-of-care (e.g., anemia (6.334), asthma (3.496), allergic rhinitis (6.479), and sinusitis (3.529), all significant under the Z-test). Developmental disorders were determined to be difficult to study due to extremely low prevalence in the practice, potentially attributable to high rates of vaccine cessation upon adverse events and family history of autoimmunity. Remarkably, zero of the 561 unvaccinated patients in the study had attention deficit hyperactivity disorder (ADHD) compared to 0.063% of the (partially and fully) vaccinated. The Highwire - Flu shots for Dummies September 2020 Dr Jim Meechan and Del Bigtree talk about the Twindemic As mainstream media pushes “Twin-demic” panic, claiming the only answer is the flu shot, Dr. Jim Meehan, MD, sits down with Del to thoroughly look at science behind the flu shot’s effectiveness and safety, providing everything you need to know to make an informed decision on whether to inject yourself and your kids this fall. 1986 - The Act Childrens Health Defense.org It was four years in the making, but the time has come for Andy Wakefield to announce the release of his next film, “1986: The Act“, streaming online July 8, 2020. Man and microbe, from Polio to COVID19… a never more relevant forensic examination of the 1986 National Childhood Vaccine Injury Act and its consequences. What happens when an ancient wisdom – a mother’s intuition – is pitted against powerful interests in a race against time? More information . Watch the trailer: Corvelva - Vials of Filth - Contaminated vaccines
Bombshell - Corvelva releases next vaccine analysis results. CORVELVA Experts wrote: “We have continued the investigation, both chemical and biological, on the Priorix Tetra, quadrivalent against measles, rubella, mumps and varicella and we have also found …Within the GlaxoSmithKline Priorix Tetra vaccine, Proteobacteria, Platyhelminthes and Nematoda worms, 10 other viruses to ssRNA, Microviridae (bacterial or phage viruses) and numerous retroviruses including endogenous human and avian retroviruses, avian viruses, human immunodeficiency and immunodeficiency virus of monkeys (fragments that if inserted into the database detect fragments of HIV and SIV), murine virus, horse infectious anemia virus, lymphoproliferative disease virus, Rous sarcoma virus. Other viruses like alphaendornavirus and hepatitis b virus, yeast virus.” Corvelva - APDB Amphetamine in Gardasil 9 A further analysis of Gardasil 9 - discovered the presence of APDB Amphetamine in the vaccines. In analyzing the Gardasil 9 papillomavirus vaccine, from a metagenomic and chemical point of view, we found many non-conformities that, to our opinion, they should require the authorities to re-analyze at least the lots analyzed by us, the immediate withdrawal if our data are confirmed and a wider re-evaluation of the analysis to be performed on all the vaccines on the market. From what we could see the problems were, under the metagenomic profile, the presence of adventitious genetic material presents such as bacteria, human and mouse DNA, adventitious viruses like phages and retroviruses and yeasts. What most impressed us was the presence of L1 fragments of the genome of papillomavirus. These fragments should not be present in the vaccine because the papillomavirus is carcinogenic and their presence together with the aluminum adjuvant is believed to be the cause of some of the serious adverse reactions in the injured. The same chemical analysis, even if shocking due to the number of potential non-residual contaminants found, had left a huge question mark. The analysis with the technology used in the laboratories we identified, gave us 338 signals of which only 22% are known. What has seemed to many unbelievable, that is the list of the probably identified compounds, in reality, to us, it created enormous interest the remaining 78% not known. A study of this unknown 78% started a further study and, after repeated analysis carried out in two different laboratories and with two different instruments, we can now tell you that a signal we found, compared to three databases consulted, leads us to determine that in some lots of Gardasil 9, especially in lot R009338, there is a contamination corresponding to an amazing drug called APDB. Corvelva analysis - Contaminated vaccines All risk and no benefit. The first vaccine they thoroughly tested was Infanrix Hexa – a six-in-one vaccine manufactured by GlaxoSmithKline (GSK) that is *supposed* to contain the following antigens: tetanus, diphtheria and pertussis toxoids; inactivated poliomyelitis viral strains 1-2-3; and hepatitis B surface antigen. Shockingly, Corvelva found NONE of these antigens in the vaccine, meaning, that NO antibodies to the intended antigens will be created. And it gets worse. In addition to no vaccine antigens, they found the following:
|
As usual Natural Immunity - saves the day and makes the Vaccines look better than they are.
The World is Screaming - WAKEN UP!
Karma, in The Form Of Robert F. Kennedy Jr., Has Finally Caught Up With Big Pharma! - Rumble - 15th November 2024
"For many years, I was saying not one of the 72 vaccines mandated for children has ever been safety tested in pre-licensing placebo-controlled trials, not one. Tony Fauci was saying he's lying. In 2016, President Trump appointed me to run a vaccine safety commission, and he ordered Fauci and Collins to meet with me with White House counsel, present. And I said to Fauci at that meeting, you say I'm lying for eight years, you've been saying I'm lying about this, show me the study." Expert Attorney Exposes Decades Of Fluoride Harms - The Highwire - 31st October 2024
Fresh off a historic win against the EPA over the use of fluoride in drinking water, lead attorney for the plaintiffs, Michael Connett, Esq., discusses the decades-long concealment of the significant harms fluoride poses to human health and its implications for the future of water fluoridation. Study Shows 450 Percent Jump in Adult Autism Diagnoses, Suggesting a Trend in Late Diagnosis - Epoch Health - 30th October 2024
The number of Americans diagnosed with autism spectrum disorder (ASD) has nearly tripled over the past decade, with young adults aged 26 to 34 showing the most dramatic surge—a 450 percent increase, according to a new cross-sectional study published in JAMA Psychiatry on Wednesday. Breaking: 188% Rise in Mortality Risk Among New Zealand Teens Following Covid-19 Vaccination - Hatchard Report - 24th October 2024
How has Health New Zealand missed a massive death signal among young age groups in New Zealand following mRNA COVID-19 vaccination? New OIA data shows a 188% rise in the 3 month mortality risk among the 12-19 age group following mRNA vaccination and an 83% rise in the 20-30 age group. Fluoride Finally Declared an "Unreasonable Risk" - Aaron Siri - 26th October 2024
A seven-year battle between the EPA and the public interest regarding the fluoridation of public drinking water has finally concluded. The State of Things Pandemic - Week 40 2024 - The Ethical Skeptic - 16th October 2024
A summary of excess mortality in the United States: A comprehensive analysis for Week 40 of 2024 – marking the 240th week of the SARS-CoV-2 Pandemic. This article provides an in-depth examination of various factors contributing to increased mortality rates, including an assessment of the primary causes. DMSO Could Save Millions From Brain and Spinal Injury - A Midwestern Doctor - 16th September 2024
DMSO is a remarkably safe chemical that protects cells from otherwise fatal stressors (e.g., freezing, burning, shockwaves, ischemia). Since the heart, brain, and spinal cord are particularly vulnerable to injury, DMSO can produce miraculous results for those conditions. SARS-CoV-2 specific plasma cells are not durably established in the bone marrow long-lived compartment after mRNA vaccination - Nature Medicine - 27th September 2024
"While serum IgG titers specific for influenza and tetanus correlated with IgG LLPCs, serum IgG levels for SARS-CoV-2, which waned within 3–6 months after vaccination, were associated with IgG non-LLPCs. In all, our studies suggest that rapid waning of SARS-CoV-2-specific serum antibodies could be accounted for by the absence of BM LLPCs after these mRNA vaccines." Proud to Be Suing Hospitals and Doctors That Inject Hep B Vaccines Into Newborns Without Parental Consent - Aaron Siri - 21st September 2024
ICAN is supporting an initiative that is long overdue: suing doctors and hospitals that inject newborns with a hepatitis B vaccine without parental consent. The hepatitis B vaccine is a case study in agency capture. The target for this product was sex workers and intravenous drug users, and the rare pregnant mother who was hepatitis B positive. The problem was that CDC could not get the sex workers and intravenous drug users to take this product. FDA Approves Vaccine for Mpox - Warns It May Cause Death in Vaccinated and People They Come in Contact With - The Defender - 17th September 2024
ACAM2000, a vaccine approved last month by the FDA for mpox, comes with a list of “serious complications,” including myocarditis, death and fetal death. The FDA’s medication guide also warns that people who receive the vaccine may spread it to unvaccinated people, who also risk developing vaccine side effects, including death. COVID vax: Some batches increase your all-cause mortality by 9X or more. - Steve Kirsch - 11th September 2024
Batch analysis of the Czech Republic data comparing 1-year post-shot all-cause mortality rates shows some batches are 3X deadlier than other batches from the same manufacturer when given at the same time to the same age 5-year age group. And a Moderna batch can be 8X or more deadlier than a Pfizer batch given at the same time to the same age group. This cannot happen if the vaccines are safe. COVID-19 and Carcinogenesis: Exploring the Hidden Links - Cureus - 31st August 2024
Our findings highlight the need for increased cancer surveillance in COVID-19 survivors. In the post-COVID-19 period, it can be thought that inflammation associated with excessive cytokine release, especially interleukin-6, genetic and epigenetic changes, and co-infections with oncogenic viruses such as Epstein-Barr virus or human papillomavirus may be effective in the development and progression of cancer. Further research is needed to explain the mechanisms underlying this relationship. UCSF Researchers Identify Major Driver Behind COVID and Long COVID, With Potential Treatment - Epoch Health - 30th August 2024
"Fibrin binds to proteins from the SARS-CoV-2 virus to form blood clots that are difficult to break down, the authors found. This clotting then drives the various inflammatory and neurological symptoms seen in COVID-19 and long COVID, the researchers found." Demyelination in Patients with POST-COVID Depression - MDPI - 9th August 2024
Conclusions: This study, for the first time, reveals extensive demyelination in numerous WM and GM structures in PCD, outlining IFOF demyelination as a key biomarker. Pharmacological effects of Astragalus polysaccharides in treating neurodegenerative diseases - Frontiers - 2nd August 2024
This article emphasizes the significant antioxidant, anti-inflammatory, immunomodulatory, and neuroprotective pharmacological activities of APS, highlighting their potential as promising candidates for the treatment of neurodegenerative diseases. SARS-CoV-2 Rapidly Infects Peripheral Sensory and Autonomic Neurons, Contributing to Central Nervous System Neuroinvasion before Viremia - MDPI - 28th July 2024
"Additionally, we demonstrate, in vitro, that neuropilin-1 facilitates SARS-CoV-2 neuronal entry. SARS-CoV-2 rapidly invades the PNS prior to viremia, establishes a productive infection in peripheral neurons, and results in sensory symptoms often reported by COVID-19 patients." ICAN - Informed Consent Action Network - Vaccine No Placebos - icandecide.org - 24th July 2024
None of the vaccine doses the CDC recommends for routine injection into children were licensed by the FDA based on a long-term placebo-controlled trial. Mellor-Pita et al., (July 3rd) Provide Convincing Evidence for My 2020 Hypothesis that the Spike Protein Induces Catastrophic Antiphopholipid Syndrome (CAPS) - WMC Research - 15th July 2024Is CAPS an eventual common complication (fate?) from repeated infections/exposures to the Spike Protein?
Study Identifies 31 'Biological Signatures' in Kids With Autism - The Defender - 11th July 2024
Researchers in Hong Kong identified 31 combinations — called “biological signatures” by The New York Times — of bacteria, archaea, fungi, viruses, microbial genes and metabolic pathways that appeared to be biomarkers of autism. Multikingdom and fuctional gut microbiota markers for autism spectrum disorder - Nature - 8th July 2024
Collectively, our findings highlight the potential application of multikingdom and functional gut microbiota markers as non-invasive diagnostic tools in ASD. Breaking: Israeli Study Explains How Pfizer-BioNTech mRNA Shot Causes Menstrual Irregularities - Substack - Sonia Elijah - 30th June 2024
"The impact of their results is alarming as inhibin B produced by the granulosa cells (GCs) inhibits the secretion of follicle-stimulating hormone (FSH). FSH is a crucial hormone in the reproductive system, as it stimulates the growth and maturation of the ovarian follicles which prepare the eggs for ovulation." We found that for all women tested, the FSH/InhibinB ratio was changed 2–3 folds post vaccination. The direct effect of SARS-CoV-2 virus vaccination on human ovarian granulosa cells explains menstrual irregularities - NPJ - 26th June 2024
"Human primary GCs exposed in-vitro to the Pfizer COVID-19 vaccine BNT162b2, demonstrated no change in their viability but altered mRNA transcripts, specifically of the regulatory key factors: InhibinB was upregulated, whereas AMH was downregulated." "his altered expression of InhibinB could significantly impact the HPO axis in vaccinated women and may ultimately influence the endometrium cyclicity, manifested clinically by the commonly reported changes in menstrual bleeding patterns." T-Cell Epitope Mapping of SARS-CoV-2 Reveals Coordinated IFN-y Production and Clonal Expansion of T Cells Facilitates Recovery from COVID-19 - MDPI - 22nd June 2024
Conclusion: Coordinated IFN-γ production and clonal expansion of SARS-CoV-2-specific T cells are associated with disease resolution in COVID-19. Our findings contribute to a better understanding of T-cell-mediated immunity in COVID-19 and may inform future strategies for managing and preventing severe outcomes of SARS-CoV-2 infection. Post-Covid Vax Child Deaths Much Higher Than VAERS Reports Indicate - Principia Scientific - 21st June 2024
Many VAERS reports list “age unknown” for people who were injured or died following a COVID-19 vaccine. VAERS analyst Albert Benavides said a closer look at the report summaries often reveals the victim’s age — yet VAERS doesn’t update the reports to reflect this. If it did, the number of child death reports after the vaccine would be much higher. The True Extent of Biotechnology Experimentation - It's Happening Now Hatchard.Report.com - 17th June 2024
"Biosynthetic food products are even being falsely promoted as more nutritious than organic food. None of this is backed by sound science. Although most, if not all, of these projects are doomed to fail and will ultimately disappear off the menu, along the way our taxes are being diverted to pay the handsome salaries of biotechnology schemers hungry for profit and fame, and boost corporate profits. More importantly, the experimentation will leave a toxic legacy of persistent genetic pollution which will continue to undermine plant health and human longevity through the generations." The involvement of circulating miR-146a and miR-27a in patients with atherosclerotic cardiovascular disease after SARS-CoV-2 infection - Wiley - 17th June 2024
The circulating miR-146a and miR-27a are involved in metabolism, inflammation, and immune levels in patients with ASCVD after SARS-CoV-2 infection, laying the foundation for the development of strategies to prevent the risk of SARS-CoV-2 infection in ASCVD patients. A potential association between COVID-19 vaccination. and development of alzheimer's disease - QJM - 28th May 2024
"Preliminary evidence suggests a potential link between COVID-19 vaccination, particularly mRNA vaccines, and increased incidences of AD and MCI. This underscores the need for further research too elucidate the relationship between vaccine-induced immune responses and neurodegenerative processes, advocating for continuous monitoring and investigation into the vaccines' long-term neurological impacts. How can millions of people, all exhibiting signs of COVID have whole genome sequences that match the SARS-CoV-2 reference genome if viruses don't exist? - Substack - Steve Kirsch - 14th June 2024
Millions of people with COVID symptoms were independently swabbed and sequenced using whole genome sequencing (WGS) technology. WGS uses random primers to extract genetic sequences from samples. Fauci's institute hid mpox gain-of-function plans from Congress and the media - U.S Right to Know - 11th June 2024
For nearly nine years Anthony Fauci’s institute concealed plans to engineer a pandemic capable mpox virus with a case fatality rate of up to 15 percent, congressional investigators revealed in a new report Tuesday. The 'experts' Are Still Pushing Covid Mandates - Principia Scientific - 30th May 2024
We’re in the middle of 2024, and the ‘experts’ still won’t give up their ridiculous defence of Covid mandates By now, the evidence against the effectiveness of Covid policies and so-called ‘interventions’ is overwhelming. Vaccine Risks Versus Benefits: Autism and What the Science Reveals About Childhood Vaccine Injury - Epoch Health - 23rd May 2024
If parents fully understood the risk of vaccination would so many still vaccinate their children? Professor of Biology, Brian Hooker saw a devastating turn of health in his, now adult, son following childhood vaccination. This would spark his years-long investigation into the links between vaccination and chronic illness, including autism, asthma, and autoimmune disorders. Dr. Peter McCullough: Autism, Childhood Vaccines & The Plague Of Transgenderism (Excerpt) - Rumble - Sunfellow On COVID-19
Dr. Peter McCullough: 'Art of War' Series: Who Is Winning The War Of Information? What's Behind the Fearsome Tide of Autoimmunity - Epoch Health - 24th May 2024
Our immune systems are turning against us in a growing tide of internal rebellion.Instead of attacking cancerous cells, viruses, bacteria, and other pathogens, our immune systems are increasingly attacking our own bodies. More than a hundred different types of autoimmune diseases—from Type 1 diabetes to psoriasis—afflict millions of people. Around 50 million Americans suffer an autoimmune condition and 1 in 5 will be afflicted at some point, according to the Autoimmune Association (formerly the American Autoimmune Related Diseases Association.) Naomi Wolf: U.S. Birthrate Hitting Record Lows After Mass mRNA Vaccination Campaign - Rumble - Sunfellow On COVID-19 - 29th April 2024
Aired on April 27, 2024, Naomi Wolf describes how U.S. birthrates are plummeting as the result of the mRNA vaccines. Study Finds 'Significant Increase' in Cancer Mortality After Mass Vaccination with 3rd COVID Dose - Epoch Health - 19th April 2024
Researchers observed “statistically significant increases” in mortality rates of all cancers, especially estrogen-related cancers, following mass vaccination with the third mRNA COVID-19 vaccine, according to a recent paper. Censored By YouTube: Dr. Aseem Malhotra's Helsinki District Court Testimony - Rumble - Sunfellow On COVID-19 - 15th April 2024
Dr. Aseem Malhotra's @DrAseemMalhotra testimony was delivered in the Helsinski District Court on April 12, 2024, with the understanding that any deviation from the truth would constitute perjury. 'Trail of Lies, Obfuscations and Cover-ups' :15 Federal Agencies Knew About EcoHealth's Gain of Function Proposal in 2018 But Said Nothing - The Defender - 12th April 2024
Sen. Rand Paul (R-Ky.) and the Senate Homeland Security and Governmental Affairs Committee announced on Tuesday they will investigate 15 federa agencies that were briefed in 2018 on a proposal to “insert a furin cleavage site into a coronavirus to create a novel chimeric virus that would have been shockingly similar to the COVID-19 virus.” 27% of Saudis in 'Bombshell' Study Experienced Heart Issues After mRNA COVID Shots - The Defender - 4th April 2024
More than a quarter of participants in a study from Saudi Arabia reported cardiac complications after receiving mRNA COVID-19 vaccines, and many of them required hospitalization or intensive care. Falsehood Flies, Truth Limps After It - Substack - John Leake - 5th April 2024
In 1710, Jonathan Swift noted in The Examiner: "Besides, as the vilest Writer has his Readers, so the greatest Liar has his Believers; and it often happens, that if a Lie be believ’d only for an Hour, it has done its Work, and there is no farther occasion for it. Falsehood flies, and the Truth comes limping after it; so that when Men come to be undeceiv’d, it is too late; the Jest is over, and the Tale has had its Effect…" How Animals Are Being Affected By mRNA Vaccines - Rumble - Sunfellow On COVID-19 - 3rd April 2024On April 2, 2024
Liz Churchill @liz_churchill10 writes on X: "The Nightmare continues. Please listen to this Farmer in regards to what happened to the Livestock after their ‘Covid Vaccine’. This is INFURIATING." Heart Scarring Detected Over 1 Year After COVID-19 Vaccination: Studies - Epoch Health - 27th March 2024
"A third of 60 patients with follow-up cardiac imaging done more than 12 months after their myocarditis diagnosis had persistent late gadolinium enhancement (LGE), which is, in the majority of cases, reflective of heart scarring, Australian researchers reported in a preprint of a new study, published on March 22." Be Very Afraid? CDC, Big Media Drum Up Fear of 'Deadly' Measles Outbreaks - The Defender - 20th March 2024
"Stern-looking public health officials with wrinkled brows are quoted as saying we’re about to be swallowed by a highly infectious disease that is vaccine-preventable." HPV Vaccine May Increase Risk of Several Autoimmune Diseases: Study - Epoch Health - 12th March 2024
A retrospective cohort study published on March 7 in Vaccine found that adolescent women who were vaccinated were 4.4 times more likely to develop rheumatoid arthritis than those who were not vaccinated. Similarly, vaccinated adolescent women had a 2.76 times higher chance of developing juvenile idiopathic arthritis. Senate Testimony - DNA Contamination - Anandamide - 26th February 2024
Federal Health and the COVID Cartel. What are they hiding? Health Canada Hid Their Concerns About Impurities In COVID-19 Shots from Canadians - Dr. Byram W. Bridle - Substack - 24th February 2024
The modified RNAs can get mis-read during the process of cells translating them into the intended spike protein from SARS-CoV-2. The result is that up to 8% of the proteins that an injected person’s cells make from the modRNAs are unintended, novel foreign proteins that are nothing like the target spike protein. Covid-19 mRNA Vaccines: Lessons Learned from the Registrational Trials and Global Vaccination Campaign - Jessica Rose - 25th January 2024
"Given the extensive, well-documented SAEs and unacceptably high harm-to-reward ratio, we urge governments to endorse a global moratorium on the modified mRNA products until all relevant questions pertaining to causality, residual DNA, and aberrant protein production are answered." First-trimester COVID Vaccination is 28% More Dangerous than Third-trimester, Another Study Shows - Igor Chudov - 18th February 2024
My two recent posts mentioned a disturbing pattern appearing in several studies of children born to COVID-19-vaccinated mothers. For a yet unknown reason, children born to mothers vaccinated during the first trimester of pregnancy consistently show a greater rate of developmental problems compared to vaccinations done during the third trimester. Innate immune response to SARS-CoV-2 infection contributes to neuronal damage in human iPSC-derived peripheral neurons - Wiley - 7th February 2024
"Interestingly, blockade of the Janus kinase and signal transducer and activator of transcription pathway by Ruxolitinib did not increase SARS-CoV-2 infection, but reduced neuronal damage, suggesting that an exacerbated neuronal innate immune response contributes to pathogenesis in the PNS. Our results provide a basis to study coronavirus disease 2019 (COVID-19) related neuronal pathology and to test future preventive or therapeutic strategies." The COVID Booster Cancer Time Bomb - Epoch Health - 8th February 2024
I have previously reported on my concern about the rise in stable cancer relapses that I have witnessed in my melanoma clinic. None of these patients of mine presented with the classic prodrome of relapse that I had always noticed previously, such as severe depression due to bereavement, divorce, or bankruptcy. Indeed the only thing I found they had in common was to have had a recent mRNA COVID-19 booster shot. Moderna Scientists Expose Origin of Toxicity Within Vaccine - EpochTV - 8th February 2024
A new paper published by Moderna scientists found that the technology used in Moderna’s COVID vaccine carries the risk of toxicity. mRNA COVID-19 Vaccines Caused More Deaths Than Saved: Study - Epoch Health - 3rd February 2024
With considerably lower efficacy rates, mRNA COVID-19 vaccines cause more deaths than save lives, according to a new study whose researchers called for a “global moratorium” on the shots and “immediate removal” from childhood immunization schedule. CDC Drafted Alert for Myocarditis and COVID-19 Vaccines, but Never Sent It - Epoch Health - 18th January 2024
CDC later sent alerts encouraging people to get vaccinated. The U.S. Centers for Disease Control and Prevention (CDC) prepared to alert state and local officials to an emerging connection between heart inflammation and COVID-19 vaccines, but ultimately did not send the alert, according to a new document obtained by The Epoch Times. upticks in cancer - El Gato Malo - 12th January 2024
and upticks in normalization based gaslighting "but, given the data post 2020, it seems simply wild to me to do a study like this right now and end it in 2019. that seems more than a coincidence. it seems like an attempt to normalize a more recent trend that’s accelerating aggressively before it becomes more apparent. in UK, excess deaths of younger people from cancer spiked in 2021 and blew out to 40% in 2022." SARS-CoV-2 produces a microRNA CoV2-miR-O8 in patients with COVID-19 infection - IScience - January 2024
"Interestingly, the genes targeted by CoV2-miR-O8 and upregulated during COVID-19 were associated with the type I interferon signaling pathway, including RSAD2, OAS3, IFIT1, and XAF1 (Figures 4E; Table S5). These results suggest a potential role of CoV2-miR-O8 in regulating antiviral immune responses during COVID-19 infection. The suggestion of upregulation of genes associated with the type I interferon signaling pathway directly by CoV2-miR-O8 is surprising given the more commonly accepted downregulation of target genes and the tendency of viruses to suppress interferon signaling. It requires further experimental validation as does defining targets of other SARS-CoV-2 encoded v-miRNAs." Comparison of mitochondrial response to SARS-CoV-2 spike protein receptor binding domain in human lung microvascular, coronary artery endothelial and bronchial epithelial cells - BioRxiv - 19th December 2023
"In HLMVEC, SARS-CoV-2 RBD fragmented the mitochondrial network, decreased cristae density, mitochondrial oxygen consumption and glycolysis and induced mitoROS-mediated GM-CSF and IL-1β expression in all three investigated cell types and IL-8 - in both endothelial cell types. Mitochondrial ROS control SARS-CoV-2 RBD-induced inflammation in HLMVEC, HCAEC and HBEC, with the mitochondria of HLMVEC being more sensitive to SARS-CoV-2 RBD." Fifth Dose of COVID Vaccine Fails to Boost Cellular Immunity - Epoch Health - 8th January 2024
"However, another significant facet of the COVID-19 vaccine is that it can damage our cellular immunity, especially T-cell immunity. Cellular immunity, or cell-mediated immunity, does not involve antibodies and is pivotal in preventing the severe form of COVID-19. Recent evidence shows that after a fifth vaccine booster dose, cellular immunity waned as well." "We Should Have Gotten Rid of the Vaccine a Couple of Years Ago": Professor of Oncology - Rumble - Vigilant News Network - 5th January 2024
Long after COVID, the UK is still suffering from 1,000 excess deaths a week.“Excess deaths started and correlates with the vaccine program,” says Oncology Professor Angus Dalgleish.“I find it very difficult to find people who don’t know, someone who’s had an adverse effect from the vaccine campaign.” Asymptomatic autonomic Dysregulation after Recovery from Mild COVID-19 Infection Revealed by Analysis of Heart Rate Variability Responses to Task Load - MDPI - 24th December 2023
"The functional significance of the results during the After state can be evaluated as concomitant parasympathetic hyperactivation and sympathetic deactivation after the task is over, reflected in the HF increment and LF decrement surpassing the initial Rest scores. These observations imply that the autonomic balance, sympathetic vs. parasympathetic, is shifted toward parasympathetic activation after the execution of tasks." "The functional significance of these HRV and HR abnormalities can be assessed as aberrant responses of autonomic activity to stress. Autonomic derangement in asymptomatic post-COVID-19 subjects is not salient at the resting state and during the task load but becomes apparent after the task is over and stress is reduced. This HRV profile in the post-COVID-19 subject is different from that in major depressive disorder, chronic fatigue syndrome, and normal subjects with elevated depressiveness and anxiety who show HRV abnormalities at the Rest and Task states." New FOIA'ed Data Reveal NY Vaccine Clinics Called Ambulances To Be "On Standby" - Substack - Pierre Kory, MD, MPA - 27th December 2023
"Last year, the contact decided to submit a FOIL (Freedom of Information Law) request—similar to a FOIA—to the Westchester County EMS (and the adjoining Dutchess County EMS) asking for a record of all calls whose transcripts mentioned either the word “vaccine” or “Covid-19 vaccine” in 2021." Russell Brand: Experts Are Baffled About What Is Causing Excess Deaths All Over The World - Rumble - Sunfellow On COVID-19 - 20th December 2023
With Americans continuing to die at alarming rates, even more than before the pandemic, there seems to be no apparent urgency on the part of to get to the bottom of this crisis. And as these deaths cannot be accounted for by COVID, just why are so many Americans dying early? Just How Far Will the FDA Go To Protect A Bad Drug? - Substack - A Midwestern Doctor - 10th December 2023
Every now and then, a highly profitable pharmaceutical will come along that everyone also knows is quite dangerous. Remarkably, rather than this stopping the product, it will often be pushed to market and the profits it generates will be used to ensure any objections to its safety get ignored and blown to the wayside. Japan approves self-amplifying (saRNA) COVID vaccine!?! - Substack - Meryl Nass - 13th December 2023
The approval of yet another RNA-based vaccine for COVID-19 might not seem momentous. But the endorsement last week by Japanese authorities of a jab against SARS-CoV-2 constructed using a form of RNA that can make copies of itself inside cells — the first ‘self-amplifying’ RNA (saRNA) granted full regulatory approval anywhere in the world — marks a pivotal advance. Children Vaccinated in Messenger RNA COVID-19 Trials at Higher Risk of Certain Illnesses:Study - Epoch Health - 9th December 2023
Compared to placebo recipients, children who received one of the modified messenger ribonucleic acid (mRNA) shots were at an increased risk for serious adverse events or respiratory tract infections, Dr. Christine Stabell Benn and other researchers found. Faith Immune to Facts - Substack - John Leake - 8th December 2023
A friend in Boston just sent me a Boston Globe interview with Nobel laureates Drew Weissman and Katalin Kariko in which they reaffirm their faith in the COVID-19 vaccines. Their most notable proclamation can be seen in the following screenshot. Dr. Michael Nehls: mRNA injections Erase Autobiographical Memory in Hippocampus - Rumble - DailyClout - 29th November 2023
Dr. Michael Nehls, distinguished author of The Indoctrinated Brain, describes his research and findings on the effects of mRNA on cognitive function, including damage to autobiographical memory. Outcomes after Early Treatment with Hydroxycholorquine and Azithromycin: An Analysis of 30,423 COVID-19 patients - Substack - Peter McCullough, MD - 6th November 2023
"As you can see, the most favored group was those who received the regimen of hydroxychloroquine and azithromycin early in the course of illness. Of the 30,202 patients for whom treatment information was available, 191/23,172 patients (0.82%) treated with HCQ-AZM died, compared to 344/7,030 patients (4.89%) who did not receive HCQ-AZM. All the other combinations received are reported in the figure." Dr McCullough Feted on Nasdaq Tower in NY - Substack - John Leake - 2nd December 2023
A lot can change in two years. Just before Christmas 2021, Dr. McCullough came over to my house to spend the day discussing the events set forth in our book, The Courage to Face COVID-19: Preventing Hospitalization and Death While Battling the Bio-Pharmaceutical Complex. He arrived in characteristically good spirits, even though he’d just been hit with the most outrageous attack. Pfizer Sues Poland, Demanding Money for Undelivered and Unwanted COVID Vaccines - Substack - Igor Chudov - 24th November 2023
After achieving a modest 57% COVID vaccination rate and seeing the vaccines not live up to the promise, Poles refused additional Pfizer COVID vaccine doses around April 2022. Risk of SARS-CoV-2 infection and hospitalization in individuals with natural, vaccine-induced and hybrid immunity: a retrospective population-based cohort study from Estonia - Scientific Reports - 21st November 2023
"We were able to extend the results of Gazit et al. by documenting a higher risk for infection and hospitalization caused not only by the Delta variant but also the Omicron SARS-CoV-2 variant among those with vaccine-induced immunity compared to those with natural immunity. Our study showed that natural immunity offers stronger and longer-lasting protection against infection, symptoms, and hospitalization compared to vaccine-induced immunity." 'Chair Care': New Mexico Hairstylists Being Trained Under CDC-Funded Program to Push COVID, Flu Shots - The Defender - 11th November 2023
Under “Chair Care,” a program funded by the Centers for Disease Control and Prevention, New Mexico hairstylists are paid and trained as “trusted messengers” to promote COVID-19 and flu vaccines, especially to minority and conservative clients with low vaccination rates. Most People Don't Reach Micronutrient Requirements Through Food Alone - Substack - Dr. joseph Mercola - 20th November 2023In developed countries, many people are lacking in important nutrients due to high intake of low-nutrition foods.
Exclusive: Moderna has halted a trial of a new mRNA vaccine for young people after a suspected myocarditis case - Substack - Alex Berenson - 17th November 2023
Investigators for Moderna today halted an early-stage clinical trial for its mRNA Epstein-Barr virus vaccine in adolescents after a participant in the trial developed a suspected case of myocarditis. Vitamin B12 is a limiting factor for induced cellular plasticity and tissue repair - Nature metabolism - 16th November 2023
We conclude that vitamin B12, through its key role in one-carbon metabolism and epigenetic dynamics, improves the efficiency of in vivo reprogramming and tissue repair. "House of Medicine on Fire" Dr. Peter McCullough AAPS Keynote Address - Rumble - 31st October 2023
Major academic medical centers failed with useless pandemic counter-measures including masks, lockdowns, and vaccines. They never worked to develop innovative protocols to help patients avoid hospitalization. Now emerging from the debacle, they are creating a gender crisis with clinical programs that increase the burden of psychiatric disease and mortality in our youth. Dr. McCullough explains what happened at AAPS Annual Meeting Oct 27, 2023. Insurance Industry Execs 'Alarmed' by Surge in Deaths Among Young People - But Stop Short of Blaming COVID Shots - Vigilant News - 7th November 2023
According to InsuranceNewsNet, insurers are especially concerned by data from the Centers for Disease Control and Prevention that show “mortality rates alarmingly rising for different categories,” including younger adult mortality rates that are up more than 20% above historic norms in 2023. Billions of Copies of Residual DNA in a Single Dose of COVID-19 mRNA Vaccine: Preprint - Epoch Health - 7th November 2023
A new preprint study up for peer review finds billions of residual DNA fragments in the COVID-19 mRNA vaccine vials. The lead author of the study, molecular virologist David Speicher, who has a doctorate in virology, told The Epoch Times that their study is "the largest study" on residual DNA in COVID-19 vaccines to date. Spider webs in the Pfizer closet - Anandamide - 2nd November 2023
"What is the Mystery ORF in Green on the opposite strand of Spike? Why was this ORF never disclosed despite the WHO and FDA regulation claiming all ORFs need to be identified? This seems like a major omission as FDA can’t claim this is of no consequence if regulations demand all ORFs be disclosed.That Mystery ORF's closest hits is to a protein involved in silk." 'Alzheimers's Gene' Heightens Alzheimer's Risk but the Plasmalogen Nutrient Defends Against it - Key to Cure? (Part 1) - EpochTV - 3rd November 2023
What does the "Alzheimer’s gene" reveal about the link between Alzheimer’s disease and cholesterol transport in the body? How is cholesterol transport dependent on the "mystery molecule"—plasmalogen—that can restore brain health? EXCLUSIVE: Health Canada Confirms Undisclosed Presence of DNA Sequence in Pfizer Shot - The Epoch Times - 19th October 2023Health Canada has confirmed the presence of a Simian Virus 40 (SV40) DNA sequence in the Pfizer COVID-19 vaccine, which the manufacturer had not previously disclosed.
COVID-19 Vaccines 'May Trigger' Rheumatic Inflamatory Diseases: Study - Epoch Health - 12th October 2023
A new review suggests that COVID vaccines "may trigger" rheumatic immune-mediated inflammatory diseases, including arthritis, vasculitis, lupus, and adult-onset Still's disease. On average, patients developed rheumatic diseases 11 days after vaccine administration, according to the study. Pfizer/BioNTech's "Bait-and-Switch" - Substack - Sonia Elijah - 5th October 2023
In my 28 minute interview with Joshua Guetzkow, senior lecturer at Hebrew University, he discusses how Pfizer/BioNTech’s biological product injected into the arms of billions, was not the same one used in Pfizer’s mRNA vaccine clinical trial. There’s been a “bait-and-switch”…. Why Are Vaccine Injured Patients Silenced? - Substack - A Midwestern Doctor - 23rd September 2023
One of the cruelest things about being injured by a pharmaceutical is the degree to which doctors will deny the idea that the injury happened (as acknowledging it requires them to accept the shortcomings of the medical model they’ve invested their lives into). This denial is known as medical gaslighting and it is often so powerful that friends and family members of the patient will adopt the reality asserted by those doctors and likewise gaslight the injured patient. EXCLUSIVE: An interview with Buckhaults about DNA Contamination in covid vaccines...and the FDA responds - Maryanne Demasi PHD - 22nd September 2023Earlier this year, genomics expert Kevin McKernan first discovered DNA contamination in vials of Pfizer and Moderna’s bivalent booster shots. He published his findings in a pre-print, but the research received little attention from the mainstream media.
Kevan McKernan Talks COVID Vaccine DNA Contamination, the Monkey Virus SV40 Promoter, and What's Actually in the Vaccines - EpochTV - 29th August 2023
"There are limits on how much DNA can be in a vaccine precisely because of the concern over DNA integration," says Mr. McKernan. "What we do know is in both shots, there is residual DNA, and this DNA is either right above the regulatory limit or tenfold higher." Baby Who Died 34 Hours After Vaccines Had Toxic Level of Aluminum in His Blood, Report Confirms - The Defender - 14th September 2023
The parents of 62-day-old Sawyer learned their baby’s blood contained 95 micrograms per liter of aluminum, a level that would be toxic for adults. The toxicologist who read Sawyer’s report said the aluminum and antigen levels in the blood were due to the vaccines. An article from 2021 indicates that COVID-19 can effectively be treated using antibiotics - Jessica Rose - 12th September 2023"Our results indicate that SARS-CoV-2 replicates in vitro in bacterial growth medium, that the viral replication follows bacterial growth and it is influenced by the administration of specific antibiotics."
New Book Tackles VAX VS Unvax - The Highwire - 8th September 2023
Co-Author of the New York Times Best Seller, Vax-Unvax: Let the Science Speak, Brian Hooker, PhD, details the years of research undertaken with co-author, Robert F. Kennedy Jr., to locate over 60 peer-reviewed studies, science they let speak for itself in this new book. Complete with user-friendly graphics, the book gives clear information on the outcome of those who followed the childhood vaccination schedule versus those who didn’t, and the distinctly different outcomes. COVID-19 mRNA Vaccines Reduce Immune Response to Other Infections, Potential Concern of Immune Deficiency - Epoch Health - 6th September 2023
"Vaccine-acquired immune deficiency syndrome (VAIDS) is a new colloquial term coined by researchers and health practitioners since the COVID-19 vaccine rollout. Though not recognized as a medical condition, some experts believe the COVID-19 vaccines may impair or suppress immune responses." The Healing Power of Vitamin D: What Big Pharma Doesn't Want You to Know - Vigilant News - 6th September 2023
We know the medical establishment lied to us about COVID. And according to esteemed physician Dr. Paul Marik, they are also lying to you about the sun. Must Watch: $11 Million given OB-GYNs To Lie To Moms About Safety Of mRNA-Vaccines - Rumble - Sunfellow On COVID-19 - 27th August 2023
Dr. Naomi Wolf interviews Dr. James Thorp. Dr. Thorp reveals FOIA results: $11 million to bribe OB-GYNs to lie to pregnant moms about often-abortifacient MRNA injections. Detection of recombinant Spike protein in the blood of individuals vaccinated against SARS-CoV-2: Possible molecular mechanisms - Wiley - 15th August 2023
Results: "The specific PP-Spike fragment was found in 50% of the biological samples analyzed,and its presence was independent of the SARS-CoV-2 IgG antibody titer.The minimum and maximum time at which PP-Spike was detected after vaccination was 69 and 187days, respectively." What Really Happened Inside the COVID-19 Vaccine Trials - Substack - A Midwestern Doctor - Cross Post by Robert Malone MD, MS
"Indeed. What did really happen? Why did the mRNA genetic vaccine clinical trials fail to detect the many adverse events and lack of efficacy in preventing disease and death from COVID-19? This essay provides part of the answer - overt clinical research fraud." Class switch towards spike protein specific IgG4 antibodies after SARS-CoV-2 mRNA vaccination depends on prior infection history - Nature - Scientific Reports - 13th August 2023
"However, the pattern of mRNA-vaccinated individuals without SARS-CoV-2 preinfection showed a markedly different pattern. In addition to IgG1 and IgG3 subclasses presented in all groups, a switch towards distal IgG subclasses (spike-specific IgG4 and IgG2) appeared almost exclusively in individuals who received only mRNA vaccines or were infected after mRNA vaccinations." "The proportions of the spike-specific IgG4 subclass to the sum of all spike-specific IgG antibodies were between 1 and 3% in the CONV and HOSP groups, respectively. In the vaccinated groups, we detected 16.6% of spike-specific IgG4 in the Vector/no INF group, whereas its values were as high as 41.5% and 45.7% in the mRNA → INF and mRNA/no INF groups, respectively" "In contrast to other IgG subclasses, IgG4 has immunosuppressive properties and accounts for only 4–5% of total IgG. Its interaction with the C1q molecule is weaker than that of the other subclasses, therefore, it is unable to activate the classical complement pathway. Because of its low affinity to C1q, but generally high affinity to antigen, IgG4 antibodies act as natural blocking antibodies. Till now, very few studies have reported a vaccine-induced IgG4 responses against infectious diseases. For instance, elevated IgG4 levels were shown in children who had received repeated doses of acellular pertussis vaccinations in contrast with whole-cell pertussis vaccines" "Furthermore, high levels of IgG4 expression can appear after allergen-specific immunotherapy or in several types of cancers, which is beneficial in allergic diseases but may indicate impaired humoral immunity to tumors." The Highwire Episode 332: The Forbidden Debate - The Highwire - 10th August 2023
Vaccine Maker Paul Offit, MD, and ICAN Lead Attorney, Aaron Siri, Esq, Are Engaged in The Forbidden Debate on Subtack and X(Twitter), After Years of Demand For Experts to Publicly Debate Vaccine Safety; Jefferey Jaxen Reports on College Mandates Still Being Pushed By Some Colleges and Universities, The Relentless Censorship of Experts Continues, and the Powers Pushing The Climate Crisis Narrative Now Blaming You!; MIT Research Lead Exposes potentially dangerous contamination in the COVID Vaccines Growing Number of Leprosy Cases Reported After COVID-19 Vaccination - Epoch Health - 9th August 2023
A growing number of leprosy cases are being reported after COVID-19 vaccination, including two cases in the United Kingdom that researchers said may have been caused by the vaccines. The researchers examined records from the Leprosy Clinic at the Hospital for Tropical Diseases in London. They found that of the 52 people who went to the clinic in 2021, at least 49 were vaccinated. Scotland's Covid Inquiry publishes damning report: No evidence to support face masks, lockdowns and other covid measures - The Expose - 6th August 2023
"It states that in 2020, there was either insufficient or no evidence to support the use of face masks, lockdowns, social distancing, test, trace and isolation measures in response to the covid pandemic. And, “the evidence base has not changed materially in the intervening three years.” How Did We Know That the COVID-19 Vaccines Would Decimate Global Fertility? - A Midwestern Doctor - Subatack - 29th July 2023
The Forgotten History of Elitist Population Control Programs "Reducing global population has been a consistent goal of the ruling class for centuries. While many support the abstract idea of population control, no one wants to volunteer to be the ones who are culled. The business of population control has hence been a very messy subject." 'Serious Doubt' About COVID-19 Vaccine Safety After Forced Release of 15,000 Pages of Clinical Trial Data: Legal NGO - Epoch Health - 21st Jul;y 2023
Conservative public interest advocacy group Defending the Republic (DTR) has obtained almost 15,000 pages of Moderna’s COVID-19 vaccine clinical trial data, claiming the data show an “utter lack of thoroughness” of the trials and calls the vaccine’s safety into “serious doubt.” Why Do Vaccines Continually Fail to Live Up to Their Promises? - A Midwestern Doctor - Substack - 12th July 2023
"Vaccines are often ill-suited to contain the diseases they are made for. Because of this, false promises have to be made so the public will agree to a vaccination campaign. So as time moves forward, the goalposts have to be continually moved as the vaccines fail." A Systematic Review of Autopsy Findings in Deaths after COVID-19 Vaccination - ZENODO - 6th July 2023
Findings: The most implicated organ system in COVID-19 vaccine-associated death was the cardiovascular system (53%), followed by the hematological system (17%), the respiratory system (8%), and multiple organ systems (7%). Three or more organ systems were affected in 21 cases. The mean time from vaccination to death was 14.3 days. Most deaths occurred within a week from last vaccine administration. A total of 240 deaths (73.9%) were independently adjudicated as directly due to or significantly contributed to by COVID-19 vaccination. Debunking the yellow dot lot placebo theory... - Jessicar - Substack - 3rd July 2023"By the way, this analysis in no way minimizes or undermines the findings in the Schmeling et al. study. They are absolutely right-on about those groupings, at least in the context of the blue and yellow groups. Hashtag: thegroupingsarereal.
It does, however, debunk the ‘yellow dot lots are placebos’ theory." Healthy Adults are Not the Only Ones Who Have Been Killed by Vaccines - A Midwestern Doctor - Substack - 16th June 2023
Speaking out on the vaccine issue is very difficult, especially when you actively work in the medical field. One of the biggest things that made me realize I had to were all the sudden unexplained deaths in adults I was seeing once the COVID-19 vaccines hit the market, and the fact that everyone that was supposed to prevent something like this from happening were instead burying their heads in the sand and pretending nothing was going on. Cancers & Death On The Rise: Is The Covid Vax To Blame? - The Highwire - 8th June 2023
From Episode 323: Crisis of Trust. Marianna Spring boasted about investigating the "UK conspiracy movement" and got fact-checked by a "nobody" - The Expose - 14th June 2023
Alan has been blocked by Marianna Spring, the face of BBC Verify, on Twitter. It seems she struggles with dealing with evidence and data. She obviously can’t process facts and figures or cope with reality – she would rather focus on showing off her “headshots.” Report 74: Lipid Nanoparticles Corrupt Nature - DailyClout - 5th June 2023
This report delves into the history of lipid nanoparticles, as well as their use by pharmaceutical companies as a casing for mRNA in the COVID vaccines. It concludes that the use of the lipid nanoparticles to deliver mRNA causes widespread and significant harms to the human body. Do Not Seek and Ye Shall Not Find - Where are the numbers? - Substack - 1st June 2023
There appears to have been a collective and systemic failure in flu surveillance and flu death reporting systems in the UK during 2020 and into 2021. Covid Outbreak at 99% Vaccinated CDC Function - American Faith - 30th May 2023
In a turn of events characterized by profound irony, an outbreak of the SARS-CoV-2 virus, which causes COVID-19, occurred at the 2023 Epidemic Intelligence Service (EIS) Conference hosted by the U.S. Centers for Disease Control and Prevention (CDC), itself an unrelenting promoter of the jab. It is notable that this incident raises questions about the vaccine’s efficacy, as 99.4% of the attendees reported being vaccinated, according to a press release from the agency. Looking Back on the Sadism of the Covid-19 Shaming Campaign - Matt Taibbi and Matt Orfalea - Substack - 21st May 2023There’s a scene in videographer Matt Orfalea’s arresting new “Nobody is Safe!” compilation in which Jeff Van Gundy — one of the sharpest basketball announcers alive, and one of my favorites to watch — leans back and says, “I don’t even understand what that means, ‘I’m doing my own research.’” During the pandemic we sure learned to hate people who “did their own research,” even during a preseason NBA game:
An Honest Doctor's Experiences on the Front Lines During COVID-19 - Substack - A Midwestern Doctor - 12th April 2023"
"I am a physician who stood against the false narratives swirling around COVID and for a time, it seemed like I lost. Before COVID became a public reality, I was working as a successful Trauma Surgeon and Surgical ICU Physician in the hospital that had the first diagnosed COVID case in America." Myocarditis with Ventricular Tachycardia Following Bivalent COVID-19 mRNA vaccination - Substack -Dr. Peter A. McCullough, MD, MPH
"I wonder how many elderly patients have died within a few days of the COVID-19 vaccine, unrecognized and not reported by families, doctors, or others. Only all-cause mortality data published in the coming months to years will give us a clue. In the meantime, all seniors should understand that even if prior shots were tolerated, the next one could be fatal." Episode 321: the War on Stupidity - The Highwire - 25th May 2023
Del Officially Launches ICAN Press with ‘The War on Ivermectin,’ Set to Release June 6th!; Jefferey Jaxen Reports on the Transgender Movement Targeting Those on The Autism Spectrum, RSV Vaccine Rammed Through For Pregnant Women Despite Major Safety Concerns, and Corporate Media Rebrands as ‘Fact-Checkers’ Again?; Then, W.H.O. Now Says Non-Sugar Sweeteners, Used in Foods Since 1981, are NOW Bad For Your Health?! Guests: Dr. Pierre Kory, Dr. Russell Blaylock FDA Overhaul Needed for New Vaccines and mRNA Therapies - Epoch Health - 6th May 2023
The pandemic has ended, but the introduction of the COVID-19 vaccines which use mRNA technology, signifies the start of a new era in modern medicine. The lagging regulatory framework which the FDA cobbled together specifically for mRNA vaccine approval has set the stage for adverse events related to genetic therapies using this new technology. In this series, we will reveal emerging concerns about mRNA injections related to the lipid nanoparticles, spike protein, and vaccine contamination as public documents are released. How the 'Unvaccinated' Got It Right - Epoch Health - 3rd May 2023
"If the “vaccine”-pushers had acted in good faith, then in the wake of the publication of new data throughout the pandemic, we would have been hearing (and perhaps even accepting) multiple mea culpas. We heard no such thing from political officials, revealing an almost across-the-board lack of integrity, moral seriousness, or concern with accuracy. The consequently necessary discounting of the claims previously made by officials left no trustworthy case on the pro-lockdown, pro-“vaccine” side at all." Secret CDC Report confirms over 1.1m americans have 'Died Suddenly' since the COVID Vaccine Roll-out; & further Government reports confirm the Vaccines are to blame - The Expose - 23rd April 2023
The Covid-19 injections were meant to reduce the sudden surge of deaths the USA recorded in 2020 due to the alleged Covid-19 pandemic. But unfortunately, the official figures prove that the opposite has happened. Miscarriages and Dead Infants Were Described in a Secret FDA Review, but Hidden from The Public - Igor Chudov - Substack - 24th April 2023
A new document was released to ICAN this April, thanks to a FOIA legal action that compelled the government to provide Pfizer documents they tried to keep secret for 75 years. Indeed, they had a good reason to hide it. Vaccines, The Gut + Autism - The Defender CHD.TV - 21st April 2023
In the field of autism, what can be said about the gut? And why do so many parents fear germs? Covering the topics of breastfeeding, Tylenol, GMO, USDA and more — This episode of ‘Friday Roundtable’ is one that viewers won’t want to miss! Natural IgG Anti-F (ab')2 Autoantibody Activity in Children with Autism - PubMed - 27th February 2023
Conclusions: This is the first report in autism of abnormally low natural anti-F(ab')2 autoantibody activity. The findings suggest a dysfunction of self-recognition mechanisms which may play a role in the pathogenesis of autism, especially for the severely affected children. These findings strengthen the hypothesis of an autoimmune process in autism and open the prospect of alternative medical treatment. Sequencing of bivalent Moderna and Pfizer mRNA vaccines reveals nanogram to microgram quantities of expression vector dsDNA per dose - Anandamide - 11th April 2023
"Multiple methods highlight high levels of DNA contamination in both the monovalent and bivalent vaccines." "dsDNA contamination of sequence encoding the spike protein wouldn’t require LINE-1 for Reverse Transcription and the presence of an SV40 nuclear localization signal in Pfizer’s vaccine vector would further increase the odds of integration." VAERS biggest paradigm shift in 2011 everyone missed! - WelcomeTheEagle88 - Substack - 14th April 2023
I probably said this in one hundred of my five hundred Bitchute videos, but who’s counting? I guess I will bury this factoid here and wait for a celebrity analyst freedom fighter to catch on. So check out blurb #4: Brain Injuries After COVID Vaccination - Epoch Health 12th April 2023
There are back door routes to the brain. COVID vaccine developers have traversed a path through those doors. And they knew they had entered the brain by November 2020, before the vaccine rollout. The Efficacy of COVID-19 Vaccine Boosters against Severe Illness and Deaths: Scientific Fact or Wishful Myth? - Journal of American Physicians and Surgeons - Spring 2023
Considering the already known poor efficacy against infections and transmission and the ever-growing concerns over serious, vaccine-associated adverse outcomes, the findings of this meticulous scientific investigation challenge the current (modified) narrative and serve as an urgent call for the medical community to reconsider the balance between the benefits and the risks of the newly developed COVID-19 vaccines An oral vaccine for SARS-CoV-2 RBD mRNA-Bovine milk-derived exosomes induces a neutralizing antibody response in vivo - BioRxiv - 22nd December 2022
"These results indicated that bovine milk-derived exosome-based mRNA vaccine could serve as a new strategy for preventing SARS-CoV-2 infection. Meanwhile, it also can work as a new oral delivery system for mRNA." Probiotics Kill Subway Pathogens Better Than Bleach: Study - Epoch Health - 6th April 2023
Decontaminating subway trains with a probiotic-based cleaning solution was found far more effective than chlorine-based cleaners at killing pathogens, including SARS-CoV-2, the virus responsible for causing COVID-19. Evolving understandings for the roles of non-coding RNAs in autoimmunity and autoimmune disease - ScienceDirect - 7th November 2022
"Autoimmune diseases (ADs) are characterized by aberrant generation of autoreactive immune cells and persistent inflammation, leading to tissue destruction. Although common definitive pathogenesis mechanisms of ADs remain elusive, increasing recent evidence has found that non-coding RNAs (ncRNAs) are extensively involved in ADs and AD-related immune responses." Autism Spectrum Disorder and Gender Dysphoria - Peter A. McCullough - Substack - 3rd April 2023
The CDC indicates that 1 in 36 children has been identified with autism spectrum disorder (ASD) according to estimates from CDC’s Autism and Developmental Disabilities Monitoring (ADDM) Network. This represents a sharp increase up from 1 in 10,000 in 1970. There has also been a less well delineated rise in gender dysphoria (GD) which is driving the clinical development of transgender medicine. Functional neurological disorder after COVID-19 and SARS-CoV-2 vacines - Robert W Malone MD, MS - Substack - 28th March 2023
"Patients with functional neurologic disorder (FND) after SARS-CoV-2 infection had different symptoms than people with FND after COVID vaccines, retrospective data showed." Ending the covid debate for good - Chris Waldburger - Substack - 23rd March 2023
The results are in on lockdowns, masks, and vaccines. This brief post provides definitive answers on the questions we have endlessly and exhaustingly debated. It is thus a ‘pocket’ resource for my readers to be certain and clear on the three big issues - lockdowns, masks, and vaccines. Anybody clinging to the old narrative is either a fanatic or a liar. UCSF Orders Their doctors to Ignore COVID Vaccine Injuries - DailyClout - Steve Kirsch - 22nd March 2023
They don’t file VAERS reports either. That’s a violation of federal law. I had a bunch of questions for their media relations department, but they ghosted me. Here’s what I wanted to know. UK Government confirms 1 in every 310 people died within 48 days of receiving the first COVID Vaccine Booster - The Expose - 21st March 2023
Official figures published by the UK Government confirm 1 in every 310 people who received a third dose of the Covid-19 injection in England by 31st December 2021, sadly died within 48 days. All Vaccines Perform Worse Than Natural Immunity Against COVID: Systematic Review and Meta-Analysis - Epoch Health - 16th March 2023
While it has become a fact that vaccines have performed drastically worse during the Omicron era, a recent meta-analysis accounting for dozens of studies reveals that natural immunity offers better protection against reinfection, symptomatic infections, and severe disease from all COVID-19 variants than all the COVID vaccines. In addition, natural immunity offered the advantage of reducing viral rebound compared with full vaccination. FDA declares that rare neurological disorder Guillain-Barre syndrome (GBS) is an important potential risk of Pfizer's RSV vaccine; it's imperative then that FDA demands Pfizer perform safety studies - Dr Paul Alexander - Substack - 13th March 2023
Given the temporal association and biological plausibility, FDA agrees with the assessments of the investigators that these events were possibly related to study vaccine. Why the Body Attacks Itself after COVID-19 Vaccination - Peter A. McCullough, MD, MPH - Substack - 8th March 2023
Autoimmunity is a Direct Consequence of Poorly Conceived Genetic Vaccines The human immune system is designed to recognize foreign invaders (microbes, other substances) attack, kill, and then clear the debris away. For that reason, we must be sure that our bodies recognize our own cells as “protected” and the foreign ones as targets. SARS-CoV-WIV - The renaming of SARS-CoV-2 - Robert W. Malone MD, MS - Substack - 3rd March 2023
Over a year ago, Project Veritas broke an enormous story that never quite made it to the state-sponsored “main stream” media. The story and supporting documents can be found on their website: " Military Documents About Gain of Function Contradict Fauci Testimony Under Oath" Episode 309: Busted Highwire - 2nd March 2023
NY Post Exposes 10 Myths told by ‘experts’ about COVID. How Many Did You Get Right?; Former Executive Pushed Out By Levi’s Over Covid Stance Protecting Children; Covering Up Wuhan Pays At The W.H.O.; Ohio Chemical Leak Update Leaves More Questions Than Answers; Mrs. Universe Uses Platform to Inform and Inspire For Autism; Woody Harrelson Stirred it Up On SNL No way! No, can't be true that there was not one (Zero) death in Scotland during COVID for all 3 years among doctors, nurses, shop workers, police & all school teachers; was this a fraud pandemic? - Substack - Dr. Paul Alexander - 28th February 2023
"in all of these employment sectors that were in touch with people, not one death? Not one! So much for a pandemic-level event! We were lied to people, in US, Canada etc. & truth is coming!" The Commissioners Letter - Karen Kingston - Substack - 21st February 2023
This is the blueprint on how to articulate to local government officials and law enforcement that the COVID-19 injections are bioweapons and how they can either report a crime or be an accomplice. While you were distracted... the UK Government quietly published a report confirming the Vaccinated account for 9 in every 10 COVID Deaths over the past TWO Years - The Expose - 22nd February 2023
Official figures quietly published by the UK Government reveal that the fully/triple/quadruple vaccinated population has accounted for 9 in every 10 Covid-19 deaths in England over the past two years and 92% of Covid-19 deaths throughout the entirety of 2022. Vaccinated blood is Contaminated with COVID Vaccine mRNA, Study Finds - Igor Chudov - Substack - 19th February 2023
Is "Vaccinated Blood" Safe? The scientists, while studying “something else” related to hepatitis, decided to test blood samples of their patients who got vaccinated for COVID-19 with mRNA vaccines for the presence of vaccine mRNA. Breaking: Australia's drug regulator hid vaccine deaths from the public, concerned that 'disclosure could undermine public confidence' - Dystopian Down Under - 15th February 2023
The hidden deaths include two children, 7 and 9 years old, who both suffered fatal cardiac arrests which the TGA assessed as causally linked to Covid vaccination Age-statified COVID-19 vaccine-dose fatality rate for Israel and Australia - ResearchGate - February 2023
ABSTRACT: It is now well established from autopsy studies and adverse effect monitoring that the COVID-19 vaccines can cause death. The vaccine-dose fatality rate (vDFR), which is the ratio of vaccine-induced deaths to vaccine doses delivered in a population, has recently been measured by us to be as large as 1 % in India and when “vaccine equity” campaigns were applied in high-poverty states of the USA, and to be 0.05 % in Australia, with data that is not discriminated by age group. More than 217,000 Americans Killed by the COVID Jab: Survey Estimate - Epoch Health - Joseph Mercola - 7th February 2023
You’ll never guess how many have been killed or seriously injured in just the first year. Yet, the FDA and CDC keep pushing the shots, despite their own trial data showing they have no benefit in terms of reducing your risk of hospitalization or death. CDC Reports Hundreds of Guillain-Barre Cases with mRNA COVID-19 Vaccination - Peter A. McCullough, MD, MPH - 5th February 2023
One of the early product warnings came in July 2021 with COVID-19 vaccination was Guillain-Barre Syndrome (GBS) or life-threatening ascending paralysis with the Janssen adenoviral COVID-19 vaccine. Using VAERS, Abara et al reported 211 cases of GBS submitted from December 2020 through January 2022 occurred with mRNA vaccines (Pfizer, Moderna) presenting with symptoms 8-10 days after taking the shot. How to create the illusion your vaccine is 90% effective - Norman Fenton and Martin Neil - Substack - 3rd February 2023
Spoiler: A major study claimed the covid vaccines are over 90% effective. But when you look at the details of the study you find that a whopping 37.2% of all vaccinated participants who were tested within 14 days of the first dose were confirmed as covid cases. None of these ‘cases’ were counted in the efficacy calculation. Also, out of the subset of 1,482 participants with confirmed symptomatic covid, that were part of the study, not a single one died, despite 812 of these being unvaccinated. Where would we all be if the "vaccines" had been effective? In a dystopian nighmare. - The Exose - 2nd February 2023
It’s a blessing covid injections are ineffective because think what a different world we would be living in right now if they weren’t. All the discrimination against and restrictions placed on the unvaccinated would cause some to say they were justified. The discrimination and restrictions would most likely have intensified and become the “new normal.” Identification of a molnupiravir-associated mutational signature in SARS-CoV-2 sequencing databases - MedRxiv - 26th January 2023
"However, it is possible that some patients treated with molnupiravir might not fully clear SARS-CoV-2 infections, with the potential for onward transmission of molnupiravir-mutated viruses. We set out to systematically investigate global sequencing databases for a signature of molnupiravir mutagenesis." Report 54: Infants and Children Under 12 Given the Pfizer mRNA COVID "Vaccine" Seven Months BEFORE Pediatric Approval. 71% Suffered Serious Adverse Events - DailyClout - 31st January 2023
The War Room/DailyClout Pfizer Documents Analysis Project Post-Marketing Group (Team 1) – Barbara Gehrett, MD; Joseph Gehrett, MD; Chris Flowers, MD; and Loree Britt – produced a shocking review of the pediatric data found in Pfizer document (a.k.a., “5.3.6“). Heart Matters With Cardiologist Assem Malhotra + Jessica Rose, PhD. - CHD.TV - 27th January 2023
Join Jessica Rose, PhD. and cardiologist Aseem Malhotra on 'Good Morning CHD' for an eye-opening dialogue about how Big Food and Big Pharma control the health of the global NEW - FDA Says Pfizer Stroke Risk is 'Significant' But Not as 'Striking' as Myocarditis - Rumble - Chief Nerd - 26th January 2023
“It doesn’t stand out as extremely striking unlike some other signals which we have seen. For example Myocarditis — that’s an extremely strong signal that you can see without any statistics.” Ivermectin Efficacy Finally Proven In 'Gold standard' RCT - Principia Scientific - 26th January 2023
Ivermectin and its use as a treatment for COVID-19 was catapulted to centre stage when the pandemic erased all rhyme and reason in 2020 However, even as the totality of evidence demonstrated Ivermectin’s efficacy, mainstream media and governments across the world dismissed its use based on the absence of randomised control trials. Vaccine Genocide: Pfizer lied and 20 Million people died in just a handful of Countries according to Secret Government Reports - The Expose - 25th January 2023
Secret reports from the Governments of the USA, Canada, Australia, New Zealand, the UK and most of Europe have raised alarm bells as they confirm that approximately 20 million deaths have been recorded resulting in 2 million excess deaths since Pfizer lied enabling the mass roll-out of the Covid-19 injections. Blame Game Begins as MHRA Passes the Buck: "All the Covid Vaccine Authorisation Decisions Were Taken by the Government Minister" - The DailySceptic - 19th january 2023
I have just received a very interesting MHRA reply to an FOI request about whether the Healthy Secretary delegated Covid vaccine decisions to the MHRA. The MHRA said: “All the Covid vaccines and therapeutics authorisation decisions were taken by the Licensing Minister and were not delegated.” Do the Mysterious Fibrous Clots Really Exist? - A Midwestern Doctor - Substack - 18th January 2023
People often have difficulty considering ideas that lie far outside of their paradigm, especially when they have no first-hand experience with them. One of the major difficulties over the past year, with which people have had to come to terms is that of people dying suddenly months after receiving a vaccination. This difficulty is because you must be open to each of the following: AMPS Warns Medical Professional of Indemnity Risks - Principia Scientific - 21st January 2023ON 11 JANUARY 2023
AMPS WROTE TO MEMBERS PROVIDING IMPORTANT INFORMATION: ADMINISTERING OF COVID-19 VACCINATION IS LIKELY NOT AN INDEMNIFIED ACTION The letter alerted doctors and nurses who may administer the Covid-19 vaccines that recent correspondence from government advisers outlined that a medical indemnity scheme for health professionals administering the COVID-19 vaccines was never established per se. Proof: Strokes are caused by the COVID vaccines - Steve Kirsch - Substack - 18th January 2023
The COVID vaccines cause strokes. There is no doubt about it. In fact, I’m so sure of this, I will bet anyone $1M that I got it right and the CDC got it wrong by dismissing the signal. I’m willing to put my money where my mouth is. Are any of the drug companies willing to do that? If they don’t, you should be worried. Very worried. The Vaccine Industry's Dirty Secret - Principia Scientific - 17th January 2023
THE vaccine industry and those who uncritically promote it will tell you that safety standards are so high, and testing so rigorous, that vaccines are totally clean and safe. However, nothing could be further from the truth. Apart from the toxic substances such as aluminium which are deliberately added, vaccines are frequently found to be contaminated with bacteria, viruses and metal particles. It is now obvious that there are multifarious health issues associated with the Covid vaccines. Many could be a result of the experimental technology, but some may be related to contamination. The Lancet has become a laughing stock - Norman Fenton and Martin Neil - 14th January 2023
"On 6 May 2021 The Lancet published a blatantly flawed study of the effectiveness of the Pfizer covid vaccine on the population of Israel, claiming it was 95% effective. On 17 May 2021 we submitted a rapid response 250 word letter explaining why the study was flawed. After an initial response saying they would ask the authors for a response to our letter we heard nothing until 20 months later." Pfizer CEO Admits No One Wants the COVID Vaccine Anymore, Predicts More "Severe Disease" Coming - Rumble - 11th January 2023
“The waves that will be coming will be coming with higher clinical manifestation of severe disease and more hospitalizations.“ Changes of ECG parameters after BNT162b2 vaccine in the senior high school students - PubMed - 5th January 2023
In total, 763 students (17.1%) had at least one cardiac symptom after the second vaccine dose, mostly chest pain and palpitations. The depolarization and repolarization parameters (QRS duration and QT interval) decreased significantly after the vaccine with increasing heart rate. Abnormal ECGs were obtained in 51 (1.0%) of the students, of which 1 was diagnosed with mild myocarditis and another 4 were judged to have significant arrhythmia. None of the patients needed to be admitted to hospital and all of these symptoms improved spontaneously. Episode 301: Pandemicology - The Highwire - 5th January 2023
U.S. Turning Away from Shots; NFL Safety Collapses; Twitter Files Update; ICAN Lead Attorney Deposes Godmother of Vaccines, Gets Shocking Admission; The Coming Famine W/ War Correspondent; The Greater Reset Guests: Peter McCullough, MD, MPH, Michael Yon, Derrick Broze COVID Boosters Trigger Metastasis - Dr. J Mercola - Substack - 5th January 2023
"Research shows SARS-CoV-2 spike protein obliterates 90% of the DNA repair mechanism in lymphocytes, a type of white blood cell that helps your body fight infection and chronic disease, including cancer" Covid Vaccine News: How much longer can Covidians keep up appearances? - The Expose - 4th January 2023
A survey in America shows that 28% of people, one in four, know someone who has died from the covid injections. A study of excess deaths in Australia finds an association between deaths and covid vaccine rollout. And infant mortality in Israel spiked after mRNA injections. A study of bivalent booster “vaccines” revealed that they have failed and the injected are more likely to get infected. The Wall Street Journal, finally, admits that covid injections are causing illness. A recently published paper found elevated levels of an unusual antibody that robs vaccinated people of a crucial immune system tool against the coronavirus and may cause cancer. A study finds booster mandates at universities in USA will cause harm.The good news is the public at large is becoming more aware of vaccine harms. Confidential Pfizer and Government Documents confirm ADE, VAED, and AIDS due to COVID-19 Vaccination has led to Millions "Dying Suddenly" & still counting - The Expose - 30th December 2022
Confidential documents reveal that within months of receiving the initial doses of the COVID-19 vaccine, some individuals are developing Antibody-dependent enhancement (ADE) and Vaccine-Associated Enhanced Disease (VAED). And as if that weren’t alarming enough, official documents also prove that a mysterious form of Acquired Immune Deficiency Syndrome is also appearing in a disturbing number of recipients just five months after their initial injections. 'XBB.1.5' is the new United States grand-daddy subvariant now displacing BQ.1.1 & BQ.1 & BA.5; data today accounts for 40.5% proportion. - Dr. Paul Alexander - Substack - 31st December 2022
Vanden Bossche, Hodkinson, I, we warned that the virus has become largely resistant to the induced vaccinal antibodies (Ab) & the non-neutralizing Abs place sub-optimal immune pressure on the antigen while infection is high; drives variants. The Highwire 300th Episode - Del Bigtree - 29th December 2022
Say Goodbye to Fauci; Dutch Farms Impediment to Mega City?; Green New Deal Falling Through; Big Food Bureaucrat Buyout; Rigged: Olivia’s Story Booster-Caused IgG4 Immune Tolerance Explains Excess Mortality and "Chronic Covid" - Igor Chudov - Substack - 26th December 2022
Rintrah Radagast posted a very important article yesterday. It shows us a potential explanation of why excess mortality is related to COVID boosters, why the association of Covid vaccines with mortality strengthens as time goes on instead of declining, and why boosted people take the longes to clear Covid-19. Check Rintrah’s article out. It is brilliant and very disturbing. Is Depopulation we are Seeing, Planned or Incidental? December Births and Deaths Update - Igor Chudov - Substack - 22nd December 2022
SUMMARY: This is my update on reductions in birth rates and increases in mortality. Such reductions in birth rates and increases in mortality are called depopulation, which we will discuss today. I will also admit my mistake regarding my past hope that the birth rate decline would be temporary. A question arises: is the current depopulation-in-progress an accident, or was it intentional and planned? Testimony Submitted by Dr. Theresa A. Deisher - Sound Choice Pharmaceutical Institute
"How might the human DNA contaminated vaccines contribute to human disease? First, there is the potential for the contaminating DNA to be mixed with our own genes by a process called homologous recombination. Homologous recombination is an established biologic phenomenon in which a segment of a cell’s DNA is substituted by another segment of DNA that is similar. This can occur during cell division or DNA repair. Homologous recombination occurs naturally to create genetic diversity in our offspring, and is also conveniently harnessed by scientists to introduce experimental DNA into cells or animals. We do not yet know if this occurs with the contaminating human DNA found in some of our vaccines, and if so, to what extent. Imagine the potential consequences of human DNA from a vaccine, a vaccine that is given to children at an average age of 15 months, being incorporated into a child’s developing brain. One does not need to be a rocket scientist to know that this potential has to be studied". Episode 298: Bringing the Heat - The Highwire - 15th December 2022
Ex-BlackRock Manager’s New Data; Return of Restrictions?; #TwitterFiles Update; DeSantis Drops Public Health Bomb; Is Del Controlled Opposition?; Laying Out ICAN’s Public Health Watchdog Work Guests: Edward Dowd, Aaron Siri, Esq. Has Big Pharma Hijacked Evidence -Based Medicine? - Epoch Health - J Mercola - 15th December 2022
Cardiologist Dr. Aseem Malhotra shares evidence of Big Pharma creating a pandemic of misinformed doctors who have unwittingly harmed and misinformed patients. A comparison of official Government reports suggests the rise in 'Strep A Child Deaths' is due to COVID Vaccination causing Acquired Immunodeficiency Syndrome - The Expose - 11th December 2022
In the spring of 2022, the World Health Organization (W.H.O.) issued a ‘global alert’ about a new form of severe hepatitis that was killing children. Then just days after the W.H.O. announcement, a new scientific study was “coincidentally” published that concluded Covid-19 vaccination has the ability to cause severe autoimmune hepatitis. Now, just a few months later, we have authorities, with the help of the mainstream media, striking the fear of god into parents across the UK in regard to the safety of their children because of an alleged spate of sudden deaths among kids due to what is normally a mild bacterial infection known as Strep A (Streptococcus A). New Autopsy Report Reveals Those Who Died Suddenly Were Likely Killed by the Covid Vaccine - Brownstone Institute - 7th December 2022
A major new autopsy report has found that three people who died unexpectedly at home with no pre-existing disease shortly after Covid vaccination were likely killed by the vaccine. A further two deaths were found to be possibly due to the vaccine. Scientists Struggle to Explain Why COVID Spared Unjabbed - Epoch Health - 6th December 2022
The media has done its best to whip people into a frenzy over the possibility of COVID, flu and respiratory syncytial virus (RSV) colliding this winter in a ‘tripledemic.’ Yet, anyone with an ounce of understanding of how viruses work knows that warped narrative is just about scientifically impossible. SARS-CoV-2 Spike Protein Induces Hemagglutination: Implications for COVID-19 Morbidities and Therapeutics and for Vaccine Adverse Effects - BioRxiv - 24th November 2022
"The results of these experiments were, first, that spike protein from these four lineages of SARS-CoV-2 induced HA. Omicron induced HA at a significantly lower threshold concentration of spike protein than for the three prior lineages and was much more electropositive on its central spike protein region. IVM blocked HA when added to RBCs prior to spike protein and reversed HA when added afterwards. These results validate and extend prior findings on the role of glycan bindings of viral spike protein in COVID-19. They furthermore suggest therapeutic options using competitive glycan-binding agents such as IVM and may help elucidate rare serious adverse effects (AEs) associated with COVID-19 mRNA vaccines which use spike protein as the generated antigen." Covid-19 Is a Deceptive Criminal Campaign - Dr. Mark Trozzi - Rumble - 26th November 2022
[FULL INTERVIEW] Dr. Mark Trozzi, never one to hold back, speaks frankly about the "Covid Criminal Enterprise," the toll on his life for speaking out and the way forward. Slew of Unusual Adverse Events Becoming More Common After COVID Vaccine Rollout - Epoch Health - 27th November 2022
"However, since the rollout of COVID-19 vaccines, a significant proportion of vaccinated people have experienced many unusual adverse events. Doctors are raising concerns. Public health officials and vaccine manufacturers are also addressing the high incidence of blood clots, myocarditis, pericarditis, and menstrual irregularities." What is Causing the Explosion of RSV? - Substack - A Midwestern Doctor - 20th November 2022
"Many of you have observed an explosion of RSV (respiratory syncytial virus, a respiratory virus that frequently afflicts children) and to a lesser extent influenza (e.g. a friend called me up today to ask if it was linked to the vaccine and many colleagues have reached out to me about the unprecedented surge they are observing in patients). Although I expected this, it is still somewhat disconcerting to see this happen as RSV is typically not a major concern outside of very specific patient populations." The Dilemma of the Vaccinated - R W Malone - Substack - 20th November 2022
"After analyzing the trends in excess mortality and disabilities post Covid-19 vaccination, we became alarmed. It looked as though our original concerns about the rapid development process of a vaccine based on a new experimental technology, which was then used to inoculate the majority of the population, had come to fruition." Great Britain has now suffered 41,000 Excess Deaths in the past 6 Months with another 2k in the last week alone - The Expose - 18th November
The Office for National Statistics (ONS) publishes weekly figures on deaths registered in England and Wales. The most recent data shows deaths up to 4th November 2022. In the week ending 4th November, there were 11,795 deaths in England and Wales, resulting in 1,517 excess deaths against the 2016-2019 + 2021 five-year average, and 1,904 excess deaths against the 2015-2019 five-year average. The increase during this week can not be blamed on Covid-19 because just 650 deaths were attributed to the alleged disease. This equates to just 5.5% of all deaths. Episode 293: Miscarriage of Science - The Highwire - 10th November 2022
Medical Freedom Midterm Wins; TSA Extends Covid Vax Requirement; New Wave of Excess Death; Whistleblower Exposes Potential Miscarriage of Science Guests: Senator Ron Johnson, James Thorp, MD, Michelle Gershman, RN. Activating the Enemy Within: COVID jabs Might Reactivate Virus and Diseases in Your Body - The Epoch Times - 12th November 2022
New evidence in the scientific community indicates that there is a strong correlation between COVID-19, its related vaccines, and the reactivation of other viruses which have previously infected the host. This article will dive deeper into the nuances. Viral load dynamics of SARS-CoV-2 Delta and Omicron variants following multiple vaccine doses and previous infection - Nature communications - 7th November 2022
"Decision makers should balance (i) judicious use of vaccine resources (ii) decreasing disease burden especially in high-risk populations (iii) false reassurance and promiscuous behavior due to the short-lived sterilizing immunity, which may deem vaccine campaigns as counterproductive epidemiologic restriction measure without proper communication with the public. Further studies should assess the differential benefits of SARS-CoV-2 vaccines in alleviating disease vs. preventing pathogen spread. Should the lack of sterilizing immunity prove consistent, it may have major ramifications on global pandemic preparedness, vaccination rollout and medical inequity. The demonstrated short-lived immunity and rapid waning on one hand, combined with the limited impact on population on the other, may focus the need for boosters for high-risk groups only, with immediate impact on vaccination campaigns and public health measures upon disease resurgence." Long-Term Organ Damage After COVID-19 Vaccines Emerging in Medical Literature - Epoch Health - 9th November 2022
"Americans were told these genetic products were brought through testing at “warp speed.” While that may be wonderful for the Starship Enterprise, warp speed should not be viewed as favorable in drug or vaccine development. Observation time in research is very important to evaluate the emergence of problems, particularly for the long-lasting mRNA vaccines and their biologic product, the coronavirus Spike protein." 'Giving People a voice' : New Platform Hopes to Shed Light on Post-Vaccine Injuries - Epoch Health - 3rd November 2022
Rather than get bogged down in the neverending debate on vaccine science, Matt Jordan set out to simply give people a voice when he launched Jab Injuries Global. The platform, which has garnered 113,000 followers on its Australian Instagram account in just 10 months, has big plans globally, with local accounts in the United States, United Kingdom, and New Zealand beginning to gain traction. Functional neurologic disorder associated with SARS-CoV-2 vaccination - PubMed - 15th August 2022
"Functional neurologic disorder associated with SARS-CoV-2 vaccination is increasingly recognized. As in all cases of FND, the key is to understand that the neurologic symptoms are a result of a “functional” disruption of brain networks rather than a recognized “structural” disorder of the nervous system. Symptoms are not voluntarily generated and should not be attributed to malingering or factitious disorders." Functional Neurological Disorder After SARS-CoV-2 Vaccines: Two Case Reports and Discussion of Potential Public Health Implications - Journal of Neuropsychiatry - 15th July 2021
Conclusions "In summary, two cases of FND were precipitated by administration of a SARS-CoV-2 vaccine. These cases highlight that FND is likely to arise in multiple cases within the large-scale SARS-CoV-2 vaccination program and should be considered as a differential diagnosis when assessing postvaccine neurological symptoms. It is hoped that informing the public about the occurrence of FND, which is real and disabling but does not implicate any vaccine constituents, will help ongoing uptake in the SARS-CoV-2 vaccination program." Vaccine-like "Inoculation" of Minds with "Weakened Forms of Misinformation" - Igor Chudov - Substack - 30th October 2022
Ever wondered why… Some of your friends refuse to even listen to fairly reasonable ideas? Fact-checkers mostly debunk absurd-sounding propositions? Some of our allies appear out of nowhere and spout outright nonsense? Episode 290: The Speed of Science - The Highwire - 20th October 2022
CDC’s ACIP Vote on Covid Vaccine for Children; Biden Extends Health Emergency; More Gain of Function?!; FL DOH Recommends Against Covid Shot; The Biggest ‘I Told You So’ Ever Guest: Joseph Ladapo, M.D. PhD Another Study Finds COVID-19 Vaccine Effectiveness Turns Negative within Months - The Epoch Times - 24th October 2022
The effectiveness of the Pfizer and AstraZeneca COVID-19 vaccines turns negative against severe COVID-19 months after administration, according to a new study. CDC Data: Moderna Causes 42% MORE Miscarriages Compared to Pfizer - Igor Chudov - Substack - 20th October 2022
This article will show that CDC’s own statistics prove beyond statistical doubt that the higher dose Moderna vaccine causes 42% MORE miscarriages, compared to the Pfizer vaccine, casting doubt on CDC’s claim that both are “safe for pregnancy”. 63K people had died within 7 weeks of receiving a Booster COVID Vaccine Dose in England between January & March 2022
The Expose - 20th October 2022 According to the UK Government institution, the Office for National Statistics (ONS), between January and March 2022, 62,801 people had sadly died within an average of 48 days after receiving a booster dose of the Covid-19 injection no later than 31st December 2021, and 4,781 of those deaths were attributed to Covid-19. Role of spike in the pathogenic and antigenic behavior of SARS-CoV-2 BA.1 Omicron - BiorRxiv - 11th October 2022
"The Omicron S-bearing virus robustly escapes vaccine-induced humoral immunity, mainly due to mutations in the receptor binding motif (RBM), yet unlike naturally occurring Omicron, efficiently replicates in cell lines and primary-like distal lung cells. In K18-hACE2 mice, while Omicron causes mild, non-fatal infection, the Omicron S-carrying virus inflicts severe disease with a mortality rate of 80%. This indicates that while the vaccine escape of Omicron is defined by mutations in S, major determinants of viral pathogenicity reside outside of S." All Vaccines Make Children and Adults Unhealthier - The Expose - 16th October 2022
Three independent studies released in 2020 compared the overall health of vaccinated, with any vaccine, and unvaccinated people and the results are striking. Everyone who is considering vaccination for themselves or their families should weigh the results of these reports before making a decision. Pfizer admits to European Parliament they NEVER tested whether Covid Vaccine prevented transmission or infection - "Get Vaccinated for Others" was always a Lie - The Expose - 12th October 2022
After Pfizer's CEO Albert Bourla declined to appear before the European Parliament to answer questions, Janine Small attended a parliamentary hearing on Monday in his stead. Member of the European Parliament (MEP) Rob Roos from the Netherlands asked her a simple “yes” or “no” question: Was the Pfizer Covid vaccine tested for stopping transmission of the virus before it entered the market? Janine Small answered “No.” This removed the entire legal basis for the Covid passport, MEP Rob Roos said. “This is scandalous. Millions of people worldwide felt forced to get vaccinated because of the myth that ‘you do it for others’.” (Updated) Exclusive Summary: COVID-19 Vaccine Concerns - Sharyl Attkisson - 9th October 2022
If you find yourself confused about the mixed guidance when it comes to Covid-19 vaccines and safety concerns, you’re not alone. While the Centers for Disease Control (CDC) is marketing widespread use of the emergency-use vaccines in the U.S. for both old and young alike, many other countries are limiting Covid-19 vaccine use. Health officials around the world are giving varying advice on safety issues as Covid-19 vaccines are given to more people, and more information can be collected. Florida Surgeon General Recommends Against mRNA COVID-19 Vaccines for Males Aged 18-39 - The Epoch Times 8th October 2022Florida's Surgeon General, Dr. Joseph A. Ladapo, announced new guidance on messenger RNA (mRNA) vaccines on Friday, specifically recommending against mRNA COVID-19 vaccines for males aged 18 to 39.
An Estimated 30,000 Americans Were Killed by Ventilators & Iatrogenesis in April 2020; RE-EXAMINING data from the US CDC on all cause excess deaths by state during peak lockdown in April 2020 - Dr. Paul Alexander - Substack - 7th October 2022
"research shows that poverty, cold weather and MECHANICAL VENTILATORS hysterical use were linked to the spring 2020 deaths; NOT a deadly strain; REMDESIVIR, diamorphine, MIDAZOLAM, ventilation KILLED!" Pfizer's "Vaccine" Causes Astonishing Drop in Male Fertility - Men Have Not Been Informed nor Given Their Consent - The Expose - 3rd October 2022
When the Covid-19 vaccine rollout to the public began in late 2020, medical professionals, public health agencies, and government spokespeople all assured the public that the novel mRNA “vaccines” did not cause negative systematic effects on human bodies. They promised the public, many of whom were sceptical about the safety of a drug brought to market at “warp speed,” that the vaccines were “safe and effective.” Nuclear translocation of spike mRNA and protein is a novel pathogenic feature of SARS-CoV-2 - BioRxiv - 27th September 2022
The spike (S) protein appears to be a major pathogenic factor that contributes to the unique pathogenesis of SARS-CoV-2. Although the S protein is a surface transmembrane type 1 glycoprotein, it has been predicted to be translocated into the nucleus due to the novel nuclear localization signal (NLS) “PRRARSV”, which is absent from the S protein of other coronaviruses. Indeed, S proteins translocate into the nucleus in SARS-CoV-2-infected cells. To our surprise, S mRNAs also translocate into the nucleus. S mRNA colocalizes with S protein, aiding the nuclear translocation of S mRNA. While nuclear translocation of nucleoprotein (N) has been shown in many coronaviruses, the nuclear translocation of both S mRNA and S protein reveals a novel pathogenic feature of SARS-CoV-2. Safe and Effective - A Second Opinion - Oracle Films - 28th September 2022
Safe and Effective: A Second Opinion shines a light on Covid-19 vaccine injuries and bereavements, but also to takes an encompassing look at the systemic failings that appear to have enabled them. We look at leading analysis of pharmaceutical trials, the role of the MHRA in regulating these products, the role of the SAGE behavioural scientists in influencing policy and the role of the media and Big Tech companies in supressing free and open debate on the subject. Liz Truss: you have all the information, and no excuses - The Children's Union - childrensunion.org - 27th September 2022
After nearly two-years of censorship, defamation and denial-of-access by the establishment, the Children’s Covid Vaccine Advisory Group was at last granted access to 10 Downing Street to present their case against the Covid vaccination of children to the British Prime Minister. Under the Skin/Documentary - Epoch Cinema - 23rd September 2022
“Under the Skin” brings a topic to the public’s attention that concerns us all: the safety of vaccinations. No medical measure interferes more intensively with the mechanisms of the immun system. At the same time, we live in a time when nearly half of the population suffers from allergies, autoimmune diseases, or other disorders of the immune system. Bert Ehgartner is specifically interested in the role of aluminum compounds, which are used as adjuvants in two-thirds of vaccinations: Why is this toxic metal compound needed? And who checks that those vaccinated are as healthy after the sting as they were before? The drug authorities care little about this, as the film shows with the example of the market launch of a new type of vaccine. Instead of the safety of the population, they stand up for the interests of the corporations. Real-world evidence from over one million COVID-19 vaccinations is consistent with reactivation of the varicell-zoster virus - PubMed - August 2022
Conclusions: Consistent with the hypothesis, a higher incidence of HZ was statistically detectable post-COVID-19 vaccine. Accordingly, the eruption of HZ may be a rare adverse drug reaction to COVID-19 vaccines. Even though the molecular basis of VZV reactivation remains murky, temporary compromising of VZV-specific T-cell-mediated immunity may play a mechanistic role in post-vaccination pathogenesis of HZ. Note that VZV reactivation is a well-established phenomenon both with infections and with other vaccines (i.e. this adverse event is not COVID-19-specific). Self-Selected COVID-19 "Unvaccinated" Cohort Reports Favorable Health Outcomes and Unjustified Discrimination in Global Survey - IJTPR - 12th August 2022
Between 57% and 61% of respondents in Southern Europe and Western Europe, Australia/New Zealand and South America, reported being targets of governmental victimization. The cohort may not be representative of widerpopulations given its reliance on self-care. The findings suggest that opting out of the world’s largest medical experiment, relying on natural immunity, self-care with supplements,and/or ivermectin or hydroxychloroquine, appeared to contribute to low incidences of severe disease, hospitalization, or death. 30 Years of Secret Official Transcripts Show UK Government Experts Cover Up Vaccine Hazards - The Expose - 21st September 2022
A 2012 article published by Child Health Safety has resurfaced. The article detailed a paper published by a courageous doctor and investigative medical researcher, Lucija Tomljenovic, who dug up the dirt on 30 years of secret official transcripts of meetings of UK government vaccine committees and the supposedly independent medical “experts” sitting on them with their drug industry connections. Dr. Ryan Cole - COVID-19 mRNA injections altering the immune systems - Rumble - 20th September 2022
Dr. Ryan Cole spoke on Saturday (Sept. 17) at the Better Way Conference in Vienna, Austria about how COVID-19 mRNA injections are damaging people's immune systems. "With a lipid nanoparticle and mRNA in a mouse study, the genes that were turned on and off in that immune system pattern were passed onto the next generation. Every litter of [mice], four litters in a row that this mom had, had these gene alterations imprinted after her immune system was altered by the shots," he said. EU forced to begin Europe-wide Investigation into 700% to 1600% increase in Excess Deaths among Children since EMA approved COVID Vaccine for Kids thanks to Exclusive Investigation carried out by the Expose - The Expose - 18th September 2022
An exclusive investigation carried out by the team here at The Exposé has forced the European Union’s official statistics department to begin a Europe-wide investigation into why there has been a significant increase in excess deaths among children aged 0 to 14 since the European Medicines Agency approved the Covid-19 injection for children. Israeli Ministry of Health Study shows a definite causal relationship between the Covid jabs and severe long-term side effects - Rumble - 28th August 2022
'What is more concerning is the response of the Ministry of Health' Prof Retsef Levi discusses the possible side effects of the Pfizer Covid vaccine, and the political response in Israel to questions about them. 'Unethical' and up to 98 Times Worse Than the Disease: Top Scientists Publish Paradigm-Shifting Study About COVID-19 Vaccines - The Epoch Times - 10th September 2022
A team of nine experts from Harvard, Johns Hopkins, and other top universities has published pardigm-shifting research about the efficacy and safety of the COVID-19 vaccines and why mandating vaccines for college students is unethical. Young Adults Dying in Record Numbers, but Not From COVID-19 - The Epoch Times - 7th September 2022
Nurse educator Dr. John Campbell is sounding the alert on a wave of unexplained deaths. According to the government data that Campbell has reviewed, many more people are dying than would be expected based on averages from the last five to seven years, and averages from years prior to COVID. Many of these excess deaths are occurring in young, otherwise healthy adults. COVID Vaccine Injury Data: 143,233 Percent Increase in Cancer - The Epoch Times - Frontline Health - 30th August 2022
When something goes wrong inside a cell’s DNA, the cell fires a signal that tells other cells, “I’ve gone bad. Please kill me.” This early warning helps the immune system stop cancer cells from multiplying. It stops a virus from replicating. So it’s a very important early response tool that works across the whole body. More Than Half of Babies, Toddlers Surveyed Had 'Systemic Reactions' After COVID-19 Vaccine - The Epoch Times - 4th September 2022
More than 55 percent of children ages 6 months to 2 years of age had a systemic reaction, which is a response beyond the injection site, in response to their first dose of the Pfizer-BioNTech or Moderna COVID-19 vaccines, the CDC said on Sept. 1, and almost 60 percent had a reaction to the second dose of the Moderna vaccine. Regular Use of Ivermectin as prophylaxis for COVID-19 Led Up to a 92% Reduction in COVID-19 Mortality Rate in a Dose-Response Manner: Results of a Prospective Observational Study of a Strictly Controled Population of 88,012 Subjects - Cureus - 31st August 2022
Conclusion: "The regular use of ivermectin decreased hospitalization for COVID-19 by 100%, mortality by 92%, and the risk of dying from COVID-19 by 86% when compared to non-users. Protection from COVID-19-related outcomes was observed across all levels of ivermectin use, with a notable reduction in risk of death in the over 50-year-old population and those with comorbidities. The reduction in infection rate was significant, irrespective of the level of ivermectin use. The results of this prospective observational study of a strictly controlled population of 223,128 participants reinforce the efficacy of ivermectin and the demonstration of a dose-response effect." 'Smoking Gun': New Acturial Report Reaffirms the Trail of Death Caused by Vaccine Mandates - Rumble - 19th August 2022
Ed Dowd: “So the window is closing on what I call the death merchants, the death dealers. The evidence is becoming overwhelming. I saw your show this morning, and the CDC is doing the one-two shuffle here to try to cover up what’s coming. They know what’s coming; it’s becoming undeniable.” Pfizer, FDA, CDC Hid Proven Harms to Male Sperm Quality, Testes Function, from mRNA Vaccine Ingredients - Daily Clout 16th August 2022
"mRNA vaccine ingredients can be transferred from one person to another via skin-to-skin contact, inhalation and via “sexual intercourse,” through bodily fluids. That is to say, vaccine “shedding” can occur via sexual contact, including via exposure to semen. [“A Phase 1/2/3, Placebo-Controlled, Randomized, Observer-Blind, Dose-Finding Study to Evaluate the Safety, Tolerability, Immunogenicity, and Efficacy of SARS-CoV-2 RNA Vaccine Candidates Against COVID-19 in Healthy Individuals,” Confidential Pfizer Documents confirm that 82-97% of COVID Vaccinated Pregnant Women sadly lost their Baby during trial - The Expose - 15th August 2022
The confidential Pfizer documents that the FDA have been forced to publish by court order reveal that 82% to 97% of women who were mistakenly exposed to the mRNA Covid-19 injection either suffered a miscarriage or suffered having to witness the death of their newborn child upon giving birth. But Pfizer falsely claimed – “There were no safety signals that emerged from the review of these cases of use in pregnancy”. Episode 280: Rigged - The Highwire - 11th August 2022
Vaxxed or UnVaxxed, It’s Back To School; HHS Escalates MonkeyPox ; HighWire Premiers New Series, ‘Rigged’, with the Tragic Account of Maddie De Garay; ICAN Obtains New Insurance Data Guests: Stephanie & Patrick De Garay, Aaron Siri, Esq. Trust in the CDC Hits an All-Time Low as Parents Overwhelmingly Say
'Not for My Child' - Rumble - 9th August 2022 Roman Balmakov: "That uptake in children almost kind of gives the game away because people can say what they want, but when the CDC says, 'Hey, you should be getting your six-month-old vaccinated,' something only like 4% of people are complying." Paxlovid Escape Mutations? - RWMalone - Substack - 7th August 2022
"President Biden continues to harbor the COVID-19 virus (SARS-CoV-2) in his body. He first contracted COVID-19 on July 21, two and a half weeks before the present. Is this because of immunosuppression - due to his heavily boosted status, or for some other reason? That being said, the single antiviral drug regime of Paxlovid may also be causing the virus to stay in his body for a long time, an effect otherwise referred to as “the rebound” effect:" VAERS Reports Suggest Experimenting on Children with Covid "Vaccines" Could Kill Them - The Expose - 4th August 2022
In the US states alone, there have been 45 reports of children dying after receiving the Covid “vaccine”. Twenty-seven of these children (60%) were perfectly healthy beforehand. Three of the children took part in the clinical trials. Shocking: UK Government admits COVID Vaccinated Children are 4423% more likely to die of any cause & 13,633% more likely to die of COVID-19 than Unvaccinated Children - The Expose - 27th July 2022
The UK Government has quietly confirmed that the Covid-19 vaccines are killing children at an unprecedented rate. Shocking figures contained in an official report, published just hours before Boris Johnson announced his resignation as Prime Minister of the UK, reveal Covid-19 vaccinated children are 4423%/45x more likely to die of any cause than unvaccinated children and 13,6333/137x more likely to die of Covid-19 than unvaccinated children. Tunneling nanotubes provide a route for SARS-CoV-2 spreading - Science Advances - 20th July 2022
"SARS-CoV-2 induces the formation of tunneling nanotubes (TNTs) and exploits this route to spread to uninfected cells. In cellulo correlative fluorescence and cryo–electron tomography reveal that SARS-CoV-2 is associated with TNTs between permissive cells. Furthermore, multiple vesicular structures such as double-membrane vesicles, sites of viral replication, are observed inside TNTs between permissive and nonpermissive cells. Our data highlight a previously unknown mechanism of SARS-CoV-2 spreading, likely used as a route to invade nonpermissive cells and potentiate infection in permissive cells." SARS-CoV-2 S1 Protein Persistence in SARS-CoV-2 Negative Post-Vaccination Individuals with Long COVID/PASC-Like Symptoms - Research Square - 12th July 2022
Conclusions "Post-vaccination individuals with PASC-like symptoms exhibit markers of platelet activation and pro-inflammatory cytokine production which may be driven by the persistence of SARS-CoV-2 S1 protein persistence in intermediate and non-classical monocytes." Dr. Peter McCullough: FDA, CDC, And NIH 'Wilfully Blind' To Vaccine Health Risks - Rumble - 6th July 2022
"There is no agency on these Covid vaccines thats protective of the safety of americans." "We should go along with the World Council for Health and pull all the vaccines off the market." Dr. Peter McCullough: FDA, CDC, And NIH 'Willfully Blind' To Vaccine Health Risks COVID -19 Jab Does Not Work, Here's Why - The Epoch Times - 11th July 2022
A team of Harvard research scientists, publishing in the New England Journal of Medicine, have found that SARS-CoV-2 virus has mutated so much that the Pfizer mRNA vaccines developed against the original Wuhan strain now have little to no effect. Whilst you were distracted By Boris resigning, the UK Gov. quietly published a report confirming the Vaccinated account for 94% of all COVID-19 Deaths since April, 90% of which were Triple/Quadruple Jabbed - The Epose - 11th July 2022
A report that was quietly published by the UK Government, just hours before Prime Minister Boris Johnson announced his resignation, reveals that Covid-19 deaths have risen dramatically among the triple vaccinated population in England over the past couple of months whilst declining drastically among the unvaccinated population. Covid-19 and the Unravelling of Experimental Medicine - Part 1 - The GMS - 2022
Two years into the pandemic, with the number of deaths over five million globally and vaccine-resistant variants continuing to multiply, scientists are in the midst of the most dangerous and ill-conceived experiment in the history of medicine. Pinning their hopes on the success of new mRNA-based vaccines that stretch all conventional notions of a vaccine, and which were hastily released without adequate efficacy and safety trials, they seek to take the wind out of the sails of a full-blown pandemic without fully understanding either the means by which ndividuals develop resistance to the coronavirus or by which herd immunity is attained. From FDA to MHRA: are drug regulators for hire? - BMJ - 29th June 2022
Patients and doctors expect drug regulators to provide an unbiased, rigorous assessment of investigational medicines before they hit the market. But do they have sufficient independence from the companies they are meant to regulate? Maryanne Demasi investigates Vaccines - Not Just COVID Shots - Linked to Type 1 Diabetes Because of Damage to These Types of Cells - The Epoch Times - 29th June 2022
Since early 2021, the Beta Cell Foundation has collected data on vaccine adverse events from 528 patients with type 1 diabetes by using an online database for analysis. The analysis showed that some patients with type 1 diabetes experienced elevated (or disturbed) blood glucose levels after vaccination with COVID vaccines. San Francisco is Another Portugal -- Worst Covid Wave Ever - Igor Chudov - Substack 29th June 2022
The icon of liberalism, as well as a bastion of “support for science” San Francisco, believes in vaccines. It is over 90% vaccinated. The city is not even reporting the exact percentage vaccinated, possibly out of embarrassment or incompetence. How do you miss the most blatant safety signal in vaccine history? - Substack - 22nd June 2022
"it’s the worst of all worlds: the illusion of safety where there is none. you are trusting in protection that does not exist." The Latest Tragedy: Sudden Adult Death Syndrome - The Epoch Times - 20th June 2022
Media outlets around the world have started highlighting a medical phenomenon called ‘sudden adult death syndrome’ – people dying with no sign of illness or underlying health condition. They simply collapse during the day or don’t wake up in the morning. While SADS has been known to occur before, what’s alarming is the sudden surge of this previously rare event. An incredible paper was just published (thank you David Wiseman for the heads up) - Unacceptable Jessica - 18th June 2022
Please read this paper entitled:" Neurotoxtic amyloidogenic peptides in the proteome of SARS-COV2: potential implications for neurological symptoms in COVID-19". It was published in Nature Communications on June 13, 2022. Adverse effects of COVID-19 vaccines and measures to prevent them - Virology Journal - 5th June 2022
"In conclusion, COVID-19 vaccination is a major risk factor for infections in critically ill patients." Pfizer, Moderna, J&J Vaccines Should Be 'Immediately Pulled Off the Market' - Dr. Peter McCullough and John Leake - The Epoch Times - 7th June 2022
“What we’ve learned is an unbelievable story of poor safety. In fact, I think it’s basically a biological catastrophe on our hands,” says Dr. Peter McCullough, an internist, cardiologist, epidemiologist, and leading expert on COVID-19 treatment. Towards the emergence of a new form of the neurodegenerative Creutzfeldt-Jakob disease: Twenty six cases of CJD declared a few days after a COVID-19 "vaccine" Jab - Zenodo - June 2022
"In a few weeks, more 50 cases of almost spontaneous emergence of Creutzfeldt-Jakob disease have appeared in France and Europe very soon after the injection of the first or second dose of Pfizer, Moderna or AstraZeneka vaccines. To summarize, of the 26 cases analyzed, the first symptoms of CJD appeared on average 11.38 days after the injection of the COVID-19 "vaccine". Of these 26 cases, 20 had died at the time of writing this article while 6 were still alive. The 20 deaths occurred only 4.76 months after the injection. Among them, 8 of them lead to a sudden death (2.5 months). All this confirms the radically different nature of this new form of CJD, whereas the classic form requires several decades." Adverse effects of COVID-19 mRNA vaccines: the spike hypothesis - Cell - 22nd April 2022
"However, adverse effects (AEs) following vaccination have been noted which may relate to a proinflammatory action of the lipid nanoparticles used or the delivered mRNA (i.e., the vaccine formulation), as well as to the unique nature, expression pattern, binding profile, and proinflam- matory effects of the produced antigens – spike (S) protein and/or its subunits/peptide fragments – in human tissues or organs. Current knowledge on this topic originates mostly from cell-based assays or from model organisms; further research on the cellular/molecular basis of the mRNA vaccine-induced AEs will therefore promise safety, maintain trust, and direct health policies." Mass Vaccination Triggers Spike in Cases, Deaths - The Epoch Times - 31st May 2022
Researchers have confirmed that it’s not the SARS-CoV-2 virus itself damaging the body’s cells, it’s the spike protein. And it does this by binding ACE2, which can lead to mitochondrial damage. Monkey Pox Update - Robert Malone MD, MS - Substack - 31st May 2022
There has been a significant development. Will the blatant fearporn ever stop? The controlled media have no shame. Data shenanigans as Sweden misleads its public over vaccination-related mortality data - Hart - 29th May 2022
"In conclusion, the correct categorization turns the vaccine efficacy calculation totally on its head, suggesting a significantly increased risk of death in the vaccinated compared to the unvaccinated, rather than the vice-versa conclusion the authorities had originally touted." True Dangers of the Spike Protein, and How to Detoxify Yourself From It - The Epoch Times - 19th May 2022
After two years of research and studies, the scientific understanding surrounding the danger of the spike protein has evolved quite a lot. At first, when the pandemic first began, people thought that the spike protein was just there to help the virus enter human cells, and that was it. However, over time, researchers have slowly discovered that the effects of the spike protein are multifaceted and that it’s harmful to the human body in at least eight different ways—such as by damaging the cells of our lungs, damaging our cells’ mitochondria, causing inflammation, and even increasing the risk of blood clots. High but Short-lived anti-SARS-CoV2 neutralizing IgM, IgA, and IgG levels among mRNA-vaccinees compared to naturally-infected participants - MedRxiv - 8th May 2022
Conclusion "While double dose mRNA vaccination boosted antibody levels, this “boost” was relatively short-lived in vaccinated individuals." How the Covid Vaccines Cripple the Immune System - Part 1 of 5: Understanding the Immune System - Rumble - 5th May 2022
"In this 5-part series Dr. Mark Trozzi explains in plain English how the Covid ‘vaccines’ cripple the immune systems of the injected. In Part 1, he explains the difference between the innate and the adaptive immune systems. This knowledge is essential to understand the other parts in this series and how the ‘vaccines’ damage the body, cripple the immune system and even cause cancers." Young Pfizer COVID-19 Vaccine Recipients More Likely to Get Infected After 5 Months - The Epoch Times - 14th May 2022
The Pfizer COVID-19 vaccine turned negatively effective after five months, according to a new study. Researchers with the U.S. Centers for Disease Control and Prevention (CDC) analyzed test results from sites across the United States and determined that the vaccine was 60 percent effective two to four weeks after 12- to 15-year-olds got the second of the two-dose primary regimen. But the effectiveness, measured against symptomatic illness, quickly plummeted, hitting 20 percent around month two and zero around month five. Anti-nucleocapsid antibodies following SARS-CoV-2 infection in the blinded phase of the mRNA-1273 Covid-19 vaccine efficacy clinical trial - MedRxiv - 18th April 2022
"Findings Among participants in the mRNA-1273 vaccine efficacy trial with PCR-confirmed Covid-19, anti-nucleocapsid antibody seroconversion at the time of study unblinding (median 53 days post diagnosis and 149 days post enrollment) occurred in 40% of the mRNA-1273 vaccine recipients vs. 93% of the placebo recipients, a significant difference." Nearly Every Facet of This "Pandemic" is Created, Spread, and Made More Deadly by The People Who Claim They Are "Experts" - The Expose - 12th May 2022S
STAT News has a new article titled, 'The 'five pandemics' driving 1 million U.S. Covid deaths'. Like almost everything they publish, the article is clever, well-written, and almost entirely wrong. The author, J. Emory Parker, claims that the pandemic is primarily a story of older, unvaccinated, rural, poor people with a deadly initial wave that has faded into a lower infection fatality rate today. I’m not going to refute it point-by-point other than to say that he is missing the forest for the trees. Nearly every facet of the pandemic is iatrogenic. Confidential Pfizer Docs. reveal 90% of Covid Vaccinated Pregnant Women lost their Baby; but Pfizer claimed: " No safety signals emerged" - The Expose - 9th May 2022
The confidential Pfizer documents that the FDA have been forced to publish by court order reveal that 82% to 97% of women who were mistakenly exposed to the mRNA Covid-19 injection either suffered a miscarriage or suffered having to witness the death of their newborn child upon giving birth. But Pfizer claimed – “There were no safety signals that emerged from the review of these cases of use in pregnancy”. The Moral Right to Conscientious Philosophical and Personal Belief: Exemption to Vaccination - Substack -3rd May 2022
Many parents… are not philosophically opposed to the concept of vaccination and do not object to every vaccine. However, they are philosophically opposed to government health officials having the power to intimidate, threaten, and coerce them into violating their deeply held conscientious beliefs in the event they conclude that either vaccination in general or, more commonly, a particular vaccine is not appropriate for their children. Video discussion between Geert Vanden Bossche - Dr Rob Rennebohm and Dr Phillip McMillan - Streamyard -14th April 2022
Dangers of continuing Mass Vaccination, which can create more virulent variants and lead to the degrading of the human innate immune system. The immunological rationale against C-19 vaccination of children - Geert Vanden Bossche - 25th April 2022
"When a deep understanding of immunology, virology, vaccinology, evolutionary biology, and molecular biology is applied to analysis of whether children should receive current vaccines against COVID-19 (C-19), it is concluded that recommendation of such vaccination is scientifically unsound and that such vaccination is harmful to individual children, children as a group, and Humanity as a whole, for the following reasons:" Moderna Knew Vaccinated People Will Never Acquire Proper Immunity After Breakthrough Infections - Igor Chudov - Substack - 26th April 2022
This study looked at two sides of the Moderna Phase 3 vaccine trial: the vaccinated group and the control group. They looked at unvaccinated people having Covid, versus vaccinated people having so called “break-through Covid infections”.The question that they asked, was: do the vaccinated acquire the same full-spectrum immunity as the unvaccinated? SARS-CoV-2 Vaccination and Myocarditis in a Nordic Cohort Study of 23 Million Residents - JAMA Network - 20th April 2022
Meaning The risk of myocarditis in this large cohort study was highest in young males after the second SARS-CoV-2 vaccine dose, and this risk should be balanced against the benefits of protecting against severe COVID-19 disease. New-onset autoimmune phenomena post-COVID-19 vaccination - PubMed - April - 2022
"Vaccination programmes are being rolled out globally, but most of these vaccines have been approved without extensive studies on their side-effects and efficacy. Recently, new-onset autoimmune phenomena after COVID-19 vaccination have been reported increasingly (e.g. immune thrombotic thrombocytopenia, autoimmune liver diseases, Guillain-Barré syndrome, IgA nephropathy, rheumatoid arthritis and systemic lupus erythematosus)." Pfizer & FDA knew Covid Vaccine caused Immunosuppression & VAED/ADE in Feb 2021; and they knew it was killing people - The Expose - 15th April 2022
On April 1, 2022, another batch of 11,000 Pfizer documents were released by the U.S. Food and Drug Administration (FDA). Pfizer trial data reveal natural immunity was as effective as the jab, and that shot side effects were more severe in those under 55.The documents also reveal that Pfizer’s consent form specifies that “the effect on sperm, fetuses and nursing children are unknown”. Yet health authorities and media have espoused as “fact” that the shot does not affect reproductive health or fertility and is perfectly safe for pregnant and nursing mothers. Cock-up or Conspiracy? Understanding Covid-19 As A 'Structural Deep Event' - The Expose 12th April 2022
As debate over ‘The Science’ has increased, people are questioning whether there was more to COVID-19 in terms of underlying agendas, in particular with respect to global-level actors. Was it incompetence or coordination? EARLY OUTPATIENT TREATMENT OF COVID-19: A RETROSPECTIVE ANALYSIS OF 392 CASES IN ITALY MedRxiv - 4th April 2022
Conclusions "This is the first study describing attitudes and behaviors of physicians caring for COVID-19 outpatients, and the effectiveness and safety of COVID-19 early treatment in the real world. COVID-19 lethality in our cohort was 0,2%, while the overall COVID-19 lethality in Italy in the same period was between 3% and 3,8%. The use of individual drugs and drug combinations described in this study appears therefore effective and safe, as indicated by the few and mild ADR reported. Present evidence should be carefully considered by physicians caring for COVID-19 patients as well as by political decision makers managing the current global crisis." Poor virus-neutralizing capacity in highly C-19 vaccinated populations could soon lead to a fulminant spread of Sars-CoV-2 super variants that are highly infectious and highly virulent in vaccinees while being fully resistant to all existing and future spike-based C-19 vaccines - Author: G Vanden Bossche, DVM,PhD - March 2022
"I SERIOUSLY expect that a series of new highly virulent and highly infectious SARS-CoV-2 (SC-2) variants will now rapidly and independently emerge in highly vaccinated countries all over the world and that they will soon spread at high pace. I expect the current pattern of repetitive infections and relatively mild disease in vaccinees to soon aggravate and be replaced by severe disease and death." Episode 261: California Screamin' - the Highwire - March 2022
California’s 10 Tyrannical Bills; FDA Shows Cards in Booster Approval; Ex-Sky News Exec Blows Whistle on Government Censorship; V is for Vaccine; A Doc Who Wants to Defeat The Mandates Guests: Amy Bohn, Mark Sharman, Josh Coleman, Jeffrey Barke, MD Persistant Cardiac MRI Findings in a Cohort of Adolescents with post COVID-19 mRNA vaccine myopericarditis - The Journal of Pediatrics - 25th March 2022
"Although symptoms were transient and most patients appeared to respond to treatment (soley with NSAIDS), we demonstrated persistence of abnormal findings on CMR at follow up in most patients, albeit with improvement in extent of LGE." Four doses of the inactivated SARS-CoV-2 vaccine redistribute humoral immune responses away from the Receptor Binding Domain - MedRxiv - 19th February 2022
"Our data reveal that immune responses could not be endlessly elevated, while suppression of heightened immune responses focusing on one subunit together with a shift of immune responses to other subunits would occur after repeated vaccination. Thus, an updated vaccine with more diverse epitopes capable of inducing NAbs against VOCs would be a future direction for boosters." ACE2-independent infection of T lymphocytes by SARS-CoV-2 - Nature - 11th March 2022
"Presence of SARS-CoV-2 in lymphocytes from patients with COVID-19 Multiple immune cell types, including lymphocytes, have been shown enriched for SARS-CoV-2 viral RNA in multiple single-cell RNA-seq studies.14,15 determine whether SARS-CoV-2 infects lymphocytes, we analyzed peripheral blood cells (PBCs) collected from COVID-19 patients. PBCs were prepared from 22 patients, who were all at severe condition during the study along with 15 healthy donors. We first analyzed major lymphocyte cell types including T (CD4 + helper T and CD8 + cytotoxic T), B, and natural killer (NK) cells for their population changes or the presence of viral antigen upon infection. For all patients tested, the ratios of blood T lymphocytes declined significantly compared to those in healthy donors, whereas B and NK cells appeared to be unaffected (Fig. 1a Notably, CD4 + and CD8 + T lymphocytes almost declined to zero in some patients (Fig. 1b). The results suggested that lymphopenia in these patients is likely attributed to a decline of T lymphocytes." Safe and Effective? What the smallpox vaccine can teach us. Robert W Malone MD, MS - Substack - 15th March 2022
"With the reveal that the objectivity of the CDC (and US HHS) has become both politicized by the executive branch and compromised by the pharmaceutical industry, we have to come to terms with living in a world in which we can no longer take governmental public health pronouncements as gospel truth." Drs. Walensky and Offit: It's All in Good Fun - Brownstone Institute - 10th March 2022
Developing psychic detachment can be an important skill, one that is not always easy to attain. We are, in many ways, primitive creatures, driven by immediate concerns. Psychic detachment is the art of using both the will and the abstracting powers of the brain to put a brake on those often quite natural and pressing drives and concerns. Planet Lockdown Film - 15th January 2022
A documentary and interview series covering the information needed to understand where we are today. The full-length film came out on January 15, 2022. You can also watch the full interviews and subscribe to our newsletter. Public Health and Medical Professionals for Transparency - March 2022
This nonprofit, made up of public health professionals, medical professionals, scientists, and journalists exists solely to obtain and disseminate the data relied upon by the FDA to license COVID-19 vaccines. The organization takes no position on the data other than that it should be made publicly available to allow independent experts to conduct their own review and analyses. Any data received will be made public on this website. Financial Rebellion Episode 12:" Time Is Up" Food Shortages, Technological Control, Great Poisoning + More - CHD - 10th March 2022
The revolution will not be centralized. Financial Rebellion is a weekly show featuring Catherine Austin Fitts and attorney Carolyn Betts, General Counsel of Solari, Inc. who call upon their years of experience in the financial and legal sectors to provide us with the tools we need to powershift our money and reclaim financial independence from the monopolizing grip of the central banks and digital currency titans. The Curtain Close on COVID Theater - Video starts at 16.1 minutes - Ron DeSantis - Rumble - 7th March 2022
Governor DeSantis hosts a roundtable with physicians nationwide on ending COVID theater once and for all. "This is Scientific Fraud" - Dr. Malone and Dr. McCullough Condemn the CDC - Rumble - 4th March 2022
"There are going to be legal consequences, and I believe they have a choice. These government employees have been participating in hiding this data. They can either be defendants or they can be witnesses." Unintended Consequences of mRNA Vaccines Against COVID-19 - Epoch Times - 3rd March 2022
MIT scientist Stephanie Seneff’s paper, “Worse Than the Disease: Reviewing Some Possible Unintended Consequences of mRNA Vaccines Against COVID-19,” published in the International Journal of Vaccine Theory, Practice and Research in collaboration with Dr. Greg Nigh, is still one of the best, most comprehensive descriptions of the many possible unintended consequences of the mRNA gene transfer technologies incorrectly referred to as “COVID vaccines.” Dr Robert Malone, Dr. Peter Mccullough, Dr. Steve Kebe (Pediatric Propaganda) - Bitchute - 1st March 2022
Discussion about vaccine mRNA adverse effects on the body and on its integration with DNA. This Evidence-Free JCVI Advice to Vaccinate Five to 11 Year-Olds Will Live in Infamy - The Daily Sceptic - 17th February 2022
Government vaccine advisory committee the JCVI has advised that a “non-urgent offer” of two weakened doses of the Pfizer vaccine be made to all children aged five to 11 years. In giving this advice, the committee is clear that the vaccines will not prevent infection or transmission and this is not the purpose of vaccinating children: “Protection against non-severe infection due to the Omicron variant is less good and is anticipated to be of relatively short-duration (weeks).” The purpose instead is “to increase the immunity of vaccinated individuals against severe COVID-19 in advance of a potential future wave of COVID-19”. MSH3 Homology and Potential Recombination Link To SARS-CoV-2 Furin Cleavage Site - Frontiers in Virology - 21st February 2022
"Among numerous point mutation differences between the SARS-CoV-2 and the bat RaTG13 coronavirus, only the 12-nucleotide furin cleavage site (FCS) exceeds 3 nucleotides. A BLAST search revealed that a 19 nucleotide portion of the SARS.Cov2 genome encompassing the furin cleavage site is a 100% complementary match to a codon-optimized proprietary sequence that is the reverse complement of the human mutS homolog (MSH3). The reverse complement sequence present in SARS-CoV-2 may occur randomly but other possibilities must be considered. Recombination in an intermediate host is an unlikely explanation. CVAG urge "pause" to child covid roll-out in light of "shocking" new data - CVAG - 10th February 2022
The Children’s Covid Vaccines Advisory Group of more than 80 doctors, professors and scientists, has written to the UK’s JCVI, the CMOs and the health secretary to urge an immediate pause to the covid vaccine roll-out for children. Here is a copy of the letter in full. Prevalence and Durability of SARS-CoV-2 Antibodies Among Unvaccinated US Adults by History of COVID-19 - Jama - 3rd February 2022
"In this cross-sectional study of unvaccinated US adults, antibodies were detected in 99% of individuals who reported a positive COVID-19 test result, in 55% who believed they had COVID-19 but were never tested, and in 11% who believed they had never had COVID-19 infection. Anti-RBD levels were observed after a positive COVID-19 test result up to 20 months, extending previous 6-month durability data." The Unintended Consequences of COVID-19 Vaccine Policy: Why Mandates, Passports, and Segregated Lockdowns May Cause more Harm than Good - SSRN - 1st February 2022
"Vaccination policies have shifted dramatically during COVID-19 with the rapid emergence of population-wide vaccine mandates, domestic vaccine passports, and differential restrictions based on vaccination status. These policies have prompted ethical, scientific, practical, and political controversy; however, there has been limited evaluation of their potential unintended consequences. Here, we outline a comprehensive set of hypotheses for why these policies may be counter-productive and harmful." Signature of long-lived memory CD8 T cells in acute SARS-CoV-2 infection - Nature - 7th December 2021
"Collectively, we describe a transcriptional signature that marks long-lived, circulating human memory CD8+ T cells following an acute viral infection." Epidemiology of Acute Mycocarditis/Pericarditis in Hong Kong Adolescents Following Comirnaty Vaccination - PubMed - 28th November 2021
"Conclusions: There is a significant increase in the risk of acute myocarditis/pericarditis following Comirnaty vaccination among Chinese male adolescents, especially after the second dose." Sacrificial Lambs? - HART - 1st February 2022
Are child deaths acceptable 'collateral damage'? Tom Chivers seems to think so. "Tom Chivers recently wrote an article in UnHerd defending the use of Covid vaccines in children. In it, he attacked HART, a body of professionals who have called for an investigation into the recent large unexplained rise in deaths of males aged 15 to 19 years old. In doing so — and by his own account — he “plays the man, not the ball”. What is more, he did this without offering HART an opportunity to comment before publication. As tempting as it was to behave in kind, HART offered UnHerd the opportunity to publish this response, which they chose not to do. Perhaps they didn’t want to draw attention to the antics of Mr Chivers." What Explains Rising Cases Among the Vaccinated? - UKCOLUMN - 20th October 2021
"This article will introduce to the reader the concept of Innate Trained immunity (ITM), and speculate how this may be playing an important but generally unrecognised part in the battle against Covid-19. By drawing on current infection data; vaccine-induced alteration of TLR function; and ITM, we will tentatively expand the original hypothesis." Dr Ryan Cole - Senator Ron Johnston - Second Opinion roundtable - Rumble - January 2022
"Dr. Ryan N. Cole received his medical degree from the Medical College of Virginia at Virginia Commonwealth University, where he was president of the student family practice association and a research associate in an immunology lab." Clinical outcomes among patients infected with Omicron (B.1.1.529) SARS-CoV-2 variant in southern California - MedRxiv - 11th January 2021
"During a period with mixed Delta and Omicron variant circulation, SARS-CoV-2 infections with presumed Omicron variant infection were associated with substantially reduced risk of severe clinical endpoints and shorter durations of hospital stay." Omicron's feeble attack on the lungs could make it less dangerous - Nature - 6th January 2022
"Mounting evidence from animal studies suggests that Omicron does not multiply readily in lung tissue, which can be badly damaged in people infected with other variants." Age-associated SARS-CoV-2 breakthrough infection and changes in immune response in mouse model - Emerging Microbes & Infections - 6th January 2022
"importantly, two-dose COVID-19 mRNA vaccination conferred limited adaptive immune response among the aged mice which rendered them susceptible to SARS-CoV-2 infection. Collectively, our findings call for tailored and optimized treatment and prevention strategies against SARS-CoV-2 among the older individuals." SARS-CoV-2 Omicron VOC Transmission in Danish Households - MedRxiv - 27th December 2021
"Among 11,937 households (2,225 with the Omicron VOC), we identified 6,397 secondary infections during a 1-7 day follow-up period. The SAR was 31% and 21% in households with the Omicron and Delta VOC, respectively. We found an increased transmission for unvaccinated individuals, and a reduced transmission for booster-vaccinated individuals, compared to fully vaccinated individuals. Comparing households infected with the Omicron to Delta VOC, we found an 1.17 (95%-CI: 0.99-1.38) times higher SAR for unvaccinated, 2.61 times (95%-CI: 2.34-2.90) higher for fully vaccinated and 3.66 (95%-CI: 2.65-5.05) times higher for booster-vaccinated individuals, demonstrating strong evidence of immune evasiveness of the Omicron VOC." Omicron infection enhances immunity against the Delta variant - MedRxiv - 27th December 2021
"Neutralization of Omicron increased 14-fold over this time, showing a developing antibody response to the variant. Importantly, there was an enhancement of Delta virus neutralization, which increased 4.4-fold. The increase in Delta variant neutralization in individuals infected with Omicron may result in decreased ability of Delta to re-infect those individuals. Along with emerging data indicating that Omicron, at this time in the pandemic, is less pathogenic than Delta, such an outcome may have positive implications in terms of decreasing the Covid-19 burden of severe disease." Horowitz: 15 studies that indicate natural immunity from prior infection is more robust than the COVID vaccines - Daniel Horowitz - 25th August 2021
"It's time to set the record straight once and for all that natural immunity to SARS-CoV-2 is broader, more durable, and longer-lasting than any of the shots on the market today. Our policies must reflect that reality." Children develop robust and sustained cross-reactive spike-specific immune responses to Sars-CoV-2 infection - Nature immunology - 22nd December 2021
"Children thus distinctly generate robust, cross-reactive and sustained immune responses after SARS-CoV-2 infection with focussed specificity against spike protein. These observations demonstrate novel features of SARS-CoV-2-specific immune responses in children and may provide insight into their relative clinical protection. Furthermore, this information will help to guide the introduction of vaccination regimens in the paediatric population." Sweden and Germany: No Deaths In Children Due to Covid - Paul Elias Alexander - Brownstone Institute - 8th December 2021
"The decision by parents to vaccinate their child against Covid is really a question of risk management. Parents must seriously consider that Covid-19 is a less dangerous illness for children than influenza. It has shown to be so and quite stably near 20 months now. Children do not readily acquire this pathogen, spread to other children, spread to adults, take it home, get severely ill, or die from it. It is that simple. We know children tend not to transmit Covid-19 virus and that the concept of asymptomatic spread has been questioned severely, particularly for children." Reduced neutralisation of SARS-CoV-2 Omicron-B.1.1.529 variant by post-immunisation serum - MedRxiv - 10th December 2021
"In this report, we present live neutralisation titres against SARS-CoV-2 Omicron variant, compared with neutralisation against Victoria, Beta and Delta variants. Sera from day-28 post second-dose were obtained from participants in the Com-COV2 study who had received a two-dose COVID-19 vaccination schedule with either AstraZeneca (AZD1222) or Pfizer (BNT162b2) vaccines. There was a substantial fall in neutralisation titres in recipients of both AZD1222 and BNT162b2 primary courses, with evidence of some recipients failing to neutralise at all. This will likely lead to increased breakthrough infections in previously infected or double vaccinated individuals, which could drive a further wave of infection, although there is currently no evidence of increased potential to cause severe disease, hospitalisation or death." Omicron incompletely escapes immunity induced by the Pfizer vaccine AHRI - 7th December 2021
"Laboratory research from South Africa strongly suggests that the SARS-CoV-2 Omicron variant escapes antibody immunity induced by the Pfizer-BioNTech (Comirnaty) vaccine, but that considerable immunity is retained in people who were both vaccinated and previously infected." Reduced Neutralization of SARS-CoV-2 Omicron Variant by Vaccine Sera and Monoclonal Antibodies
MedRxiv - 7th December "Our in vitro findings using authentic SARS-CoV-2 variants indicate that in contrast to the currently circulating Delta variant, the neutralization efficacy of vaccine-elicited sera against Omicron was severely reduced highlighting T-cell mediated immunity as essential barrier to prevent severe COVID-19. Since SARS-CoV-2 Omicron was resistant to casirivimab and imdevimab, genotyping of SARS-CoV-2 may be needed before initiating mAb treatment. Variant-specific vaccines and mAb agents may be required to treat COVID-19 due to Omicron and other emerging variants of concern." Increased risk of infection with SARS-CoV-2 Beta,Gamma, and Delta variant compared to Alpha variant in vaccinated individuals - MedRxiv - 24th November 2021
"We find evidence for an increased risk of infection by the Beta (B.1.351), Gamma (P.1), or Delta (B.1.617.2) variants compared to the Alpha (B.1.1.7) variant after vaccination. No clear differences were found between vaccines. However, the effect was larger in the first 14-59 days after complete vaccination compared to 60 days and longer. In contrast to vaccine-induced immunity, no increased risk for reinfection with Beta, Gamma or Delta variants relative to Alpha variant was found in individuals with infection-induced immunity." The epidemiological relevance of the COVID-19-vaccinated population is increasing - The Lancet - Gunter Kampf - 19th November 2021
"High COVID-19 vaccination rates were expected to reduce transmission of SARS-CoV-2 in populations by reducing the number of possible sources for transmission and thereby to reduce the burden of COVID-19 disease. Recent data, however, indicate that the epidemiological relevance of COVID-19 vaccinated individuals is increasing. In the UK it was described that secondary attack rates among household contacts exposed to fully vaccinated index cases was similar to household contacts exposed to unvaccinated index cases (25% for vaccinated vs 23% for unvaccinated)." Are We Overreacting to OmIcron? - Brownstone Institute - Paul Elias Alexander Ph.D - 26th November 2021
"With natural exposure immunity and early outpatient treatment, and when combined with no reports of increased lethality, the WHO’s reaction of generating panic toward “Omicron” is causing needless fear and panic. So too, with the Biden administration’s newly imposed travel restrictions which will achieve nothing and will once again disrupt trade and violate human rights " Pretending We Can Vaccinate Our Way Out of This Pandemic is Dangerous - Especially for Kids
The Defender - Paul Elias Alexander Ph.D. - 2nd November 2021 "Are we setting up our populations — and dangerously, our children — for disaster, with imperfect and sub-optimal immune priming caused by vaccines that do not stop infection or transmission?" Geert Vanden Bossche - Meeting of the COVID-19 Giants with Geert Vanden Bossche and Robert Malone MD - Vejon Health
"Tremendous privilege for me to host the first live discussion between two stalwarts in the COVID-19 pandemic. Both men have taken an ethical stand to focus on science and not be afraid to share their expertise." A Deep Dive Into The Real Facts About Natural Immunity: Immunologist Dr Steven Pelech - Strong and Free Canada - 4th November 2021
Dr. Pelech has been a professor of immunology and neurology at the University of British Columbia for 33 years, and is one of the founding members of the Biomedical Research Center at UBC. He is the founder of two biotech companies, and is also one of the founding members of the Canadian Covid Care Alliance and the Chair of the Scientific and Medical Advisory Committee. FDA Asks Federal Judge to Grant it Until the Year 2076 to Fully Release Pfizer's COVID-19 Vaccine Data - Aaron Siri - Protecting Freedom - 17th November 2021
The fed gov’t shields Pfizer from liability. Gives it billions of dollars. Makes Americans take its product. But won’t let you see the data supporting its safety/efficacy. Who does the gov't work for? SARS-CoV-2 Spike Impairs DNA Damage Repair and Inhibits V(D)J Recombination In Vitro - PubMed - 13th October 2021
"Here, by using an in vitro cell line, we report that the SARS-CoV-2 spike protein significantly inhibits DNA damage repair, which is required for effective V(D)J recombination in adaptive immunity. Mechanistically, we found that the spike protein localizes in the nucleus and inhibits DNA damage repair by impeding key DNA repair protein BRCA1 and 53BP1 recruitment to the damage site. Our findings reveal a potential molecular mechanism by which the spike protein might impede adaptive immunity and underscore the potential side effects of full-length spike-based vaccines." Effectiveness of Covid-19 Vaccination Against Risk of Symptomatic Infection, Hospitalization, and Death Up to 9 Months: A Swedish Total-Population Cohort Study - Lancet - 25th October 2021
"Predominance of antibody-resistant SARS-CoV-2 variants in vaccine breakthrough cases from the San Francisco Bay Area, California - MedRxiv - 19th August 2021
"These findings suggest that vaccine breakthrough cases are preferentially caused by circulating antibody-resistant SARS-CoV-2 variants, and that symptomatic breakthrough infections may potentially transmit COVID-19 as efficiently as unvaccinated infections, regardless of the infecting lineage." SARS-CoV-2 mRNA Vaccination-Associated Myocarditis in Children Ages 12-17: A Stratified National Database Analysis - MedRxiv - 30th August 2021
"Conclusions Post-vaccination CAE rate was highest in young boys aged 12-15 following dose two. For boys 12-17 without medical comorbidities, the likelihood of post vaccination dose two CAE is 162.2 and 94.0/million respectively. This incidence exceeds their expected 120-day COVID-19 hospitalization rate at both moderate (August 21, 2021 rates) and high COVID-19 hospitalization incidence. Further research into the severity and long-term sequelae of post-vaccination CAE is warranted. Quantification of the benefits of the second vaccination dose and vaccination in addition to natural immunity in this demographic may be indicated to minimize harm." Dr Richard Fleming Exposes What's Really Happening With COVID-19 And Vaccine Induced ADE - 3rd October 2021
Renowned scientist Dr. Richard Fleming visits Infowars to give a powerful, in-depth PowerPoint presentation exposing what's really happening with Covid-19 and vaccine-induced ADE (Antibody-Dependent Enhancement). Outbreak of SARS-CoV-2 B.1.617.2 (Delta) variant in a Nursing Home 28 weeks after two doses of mRNA anti-Covid-19 vaccines: evidence of a waning immunity - MedRxiv - 25th October 2021
"Conclusion Low levels of SARS-CoV-2 neutralizing anti-Spike IgG in serum 28 weeks after the administration of the second dose parallels the waning of vaccine protection." Lifesite news - Jim Hale - 16th October 2021 - Rumble
Doctor tells of horrific vaccine mandates in Dominican Republic "It was once known for being a solidly Pro-Life nation, but the Dominican Republic is now on the verge of implementing one of the most tyrannical vaccine mandates in the world." Brownstone Institute - 17th October 2021
91 Research Studies Affirm Naturally Aquired Immunity to Covid-19: Documented, Lindked, and Quoted "We should not force COVID vaccines on anyone when the evidence shows that naturally acquired immunity is equal to or more robust and superior to existing vaccines. Instead, we should respect the right of the bodily integrity of individuals to decide for themselves." Methods and systems of prioritizing treatments, vaccination, testing and/or activities while protecting the privacy of individuals - 30th November 2020
"System and methods for anonymously selecting subjects for treatment against an infectious disease caused by a pathogen. The system comprises a plurality of electronic devices comprising instructions to generate an ID and, when in proximity of another such electronic device, one or both electronic devices transmit/receive the ID to/from the other electronic device. Then, a score is generated based on a plurality of such received IDs. Additionally, based on information received from a server, relevant treatment instructions are displayed to the subjects based on the received information and the score. The server comprises instructions for sending to the plurality of electronic devices the information to be displayed with the relevant treatment instructions, additionally the server and/or the electronic devices comprise instructions to generate a prediction of likelihood of a subject transmitting the pathogen, based on the score of the subject." Renz-law.com
Serving Justice with Integrity Breaking news - whistleblower proof that we are all being lied to. Letters from Dr Patricia Lee To Dr Peter Marks Director FDA and Dr Tom Shimaukuro CDC COVID-19 Vaccine Task Force - October 6, 2021
Re: Firsthand Reports of COVID-19 Vaccine Injuries Dr. Lee’s clinical observations are particularly troubling because, as she explains, “it appears statistically improbable that any one physician should witness this many Covid-19 vaccine injuries if the federal health authority claims regarding Covid-19 vaccine safety were accurate” and that she has “spoken with colleagues who have also had similar experiences.” Winning the War Against Therapeutic Nihilism & Trusted Treatments vs Untested Novel Therapies - Association of American Physicians and Surgeons - 2nd October 2021
Peter McCullough MD, PPH speaks at the 78th Annual Meeting of AAPS on October 2, 2021 Increases In COVID-19 are unrelated to levels of vaccination across 68 countries and 2947 counties in the United States - SpringerLink - 30th September 2021
"For instance, in a report released from the Ministry of Health in Israel, the effectiveness of 2 doses of the BNT162b2 (Pfizer-BioNTech) vaccine against preventing COVID-19 infection was reported to be 39% [6], substantially lower than the trial efficacy of 96% [7]. It is also emerging that immunity derived from the Pfizer-BioNTech vaccine may not be as strong as immunity acquired through recovery from the COVID-19 virus [8]. A substantial decline in immunity from mRNA vaccines 6-months post immunization has also been reported [9]. Even though vaccinations offers protection to individuals against severe hospitalization and death, the CDC reported an increase from 0.01 to 9% and 0 to 15.1% (between January to May 2021) in the rates of hospitalizations and deaths, respectively, amongst the fully vaccinated [10]." Nosocomial ourtbreak caused by the SARS-CoV-2 Delta variant in a highly vaccinated population, Israel, July 2021 - Eurosurveillance -
"This nosocomial outbreak exemplifies the high transmissibility of the SARS-CoV-2 Delta variant among twice vaccinated and masked individuals. This suggests some waning of immunity, albeit still providing protection for individuals without comorbidities. However, a third vaccine dose may be needed, particularly in individuals with risk factors for severe COVID-19. Appropriate use of masks, especially in high-risk settings is advised." Waning immunity of the BNT162b2 vaccine: A nationwide study from Israel medRxiv - 24th August 2021
Conclusions "These results indicate a strong effect of waning immunity in all age groups after six months. Quantifying the effect of waning immunity on vaccine effectiveness is critical for policy makers worldwide facing the dilemma of administering booster vaccinations" Differential effects of the second SARS-CoV-2 mRNA vaccine dose on T cell immunity in naive and COVID-19 recovered individuals
biorxiv.org - March 2021 "On the contrary, the second BNT162b2 vaccine dose results in a reduction of cellular immunity in COVID-19 recovered individuals, which suggests that a second dose, according the the current standard regimen of vaccination, may not be necessary in individuals previously infected with SARS-CoV-2" Infection-enhancing anti-SARS-Cov-2 antibodies recognise both the original Wuhan/D614G strain and Delta variants. A potential risk for mass vaccination? - Journal of Infection 9th August 2021
"However in the case of the Delta variant, neutralizing antibodies have a decreased affinity for the spike protein, whereas facilitating antibodies display a strikingly increased affinity. Thus, ADE may be a concern for people receiving vaccines based on the original Wuhan strain spike sequence (either mRNA or viral vectors)" Imperfect Vaccination Can Enhance the Transmission of Highly Virulent Pathogens - PLOS Biology
Could some vaccines drive the evolution of more virulent pathogens? Vaccines that keep hosts alive but still allow the transmission could thus allow very virulent strains to circulate in the population. Reverse-transcribed SARS-CoV-2 RNA can integrate into the genome of cultured human cells and can be expressed in patient-derived tissues - PNAS May 2021
Delta Variant: Natural Immunity 700% better than the vaccine - Dr Mercola July 2021
Data presented to the Israeli Health Ministry July 17, 2021, revealed that, of the more than 7,700 COVID-19 cases reported since May 2021, only 72 occurred in people who had previously had Covid-19 - a rate of less than 1%. In contrast, more than 3,000 cases - or approximately 40% - occurred in people who had received a COVID-19 vaccine. In other words, those who were vaccinated were nearly 700% more likely to develop COVID-19 than those who had natural immunity from a prior infection - and this is largely in response to the Delta variant, which has led to increasing infections in Israel. President Biden Demands Mercola Be Banned from Social Media
July 2021 "In a July 16, 2021, White House press briefing, press secretary Jen Psaki admitted the Biden administration is violating the First Amendment by alerting social media companies to posts and accounts it believes is peddling “misinformation” about COVID injections This kind of corporate-government collusion to censor free speech is illegal. As noted by Supreme Court Justice Clarence Thomas, “The government cannot accomplish through threats of adverse government action what the Constitution prohibits it from doing directly” The Biden Administration wants COVID “misinformants” to be removed from all social media platforms, not just one or two In that same press briefing, Psaki also referred to the COVID shots as “approved,” and having “gone through the gold standard of the FDA approval process.” This is verifiably false. All currently available COVID injections are authorized for emergency use only. None are approved and none have finalized their safety studies Biden Administration’s call to censor — through public utilities and private companies — anyone who shares information about risks and the lack of benefit of these COVID injections must be rejected on ethical, legal and Constitutional grounds" Common Dandelion efficiently blocks interaction between ACE2 cell surface receptor and SARS-CoV-2 spike protein - bioRxiv 2021
Here we report on the efficacy of common dandelion (Taraxacum officinale) to block protein-protein interaction of spike S1 to the human ACE2 cell surface receptor. This could be shown for the original spike D614, but also for its mutant forms (D614G, N501Y, and mix of K417N, E484K, N501Y) in human HEK293-hACE2 kidney and A549-hACE2-TMPRSS2 lung cells. Dr Francis Christian FRCSEd,FRCSC
Statement 17th June 2021 "Without informed consent, the Nuremberg code is being violated – and many physicians across Canada and around the world are rising up to honor their pledge to always put their patients and humanity first." Dr Tess Lawrie (MBBCh, PhD) Director, Evidence-based Medicine Consultancy Ltd and EbMVC Squared CiC Bath, UK - Letter to the MHRA
Re: Urgent preliminary report of Yellow Card data up to 26th May 2021 "Between the 4th January 2021 and the 26th May 2021. In total, 1253 deaths and 888,196 Adverse Drug Reactions(ADRs- 256,224 individual reports) were reported during this period" Front Line Covid-19 Critical Care Alliance Prevention and Treatment Protocols for Covid-19
FLCCC President and Chief Medical Officer Dr. Kory speaks out on Wasteful and Unnecessary U.S. Government Supply Agreement with Merck Dr Charles Hoffe - How the MRNA vaccine is affecting our bodies at the cellular level - Bitchute - 22 July 2021
Informed Consent for Vaccines - Here's What You Need to Know
June 2021 Prior to taking any unapproved drug, you have the right to receive a broad and complete spectrum of information about the potential effects of those drugs on your body, in order for you to give “informed consent” or to refuse. Dr. Blaylock wrote this especially for this purpose.For anyone contemplating vaccination for the COVID virus, this is the essential information that you will not receive from your doctor or health care professional. However, all of the information presented here is already in the public domain and readily available if you know where to look for it. Dr. Blaylock has that knowledge and is sharing it with you! Circulating SARS-CoV-2 Vaccine Antigen Detected in the Plasma of mRNA-1273 Vaccine Recipients PubMed 2021 "Future studies should also examine the dynamics of antigen production with neutralization antibodies. Nonetheless, evidence of systemic detection of spike and S1 protein production from the mRNA-1273 vaccine is significant and has not yet been described in any vaccine study, likely due to limitations in assay sensitivity and timing assessment. The clinical relevance of this finding is unknown and should be further explored. These data show that S1 antigen production after the initial vaccination can be detected by day one and is present beyond the site of injection and the associated regional lymph nodes. Induction of IgG and IgA immune responses can be detected as early as day five post vaccination and are associated with clearance of spike and S1 antigen in the systemic circulation". Doctors for Covid Ethics 2021 Abstract: COVID-19 vaccine manufacturers have been exempted from legal liability for vaccine-induced harm. It is therefore in the interests of all those authorising, enforcing and administering COVID-19 vaccinations to understand the evidence regarding the risks and benefits of these vaccines, since liability for harm will fall on them. In short, the available evidence and science indicate that COVID-19 vaccines are unnecessary, ineffective and unsafe. Scientist uncover SARS-CoV-2-specific T cell immunity in revovered COVID-19 and Sars patients - Science Daily July 2020 The T cells, along with antibodies, are an integral part of the human immune response against viral infections due to their ability to directly target and kill infected cells. A Singapore study has uncovered the presence of virus-specific T cell immunity in people who recovered from COVID-19 and SARS, as well as some healthy study subjects who had never been infected by either virus. The team tested subjects who recovered from COVID-19 and found the presence of SARS-CoV-2-specific T cells in all of them, which suggests that T cells play an important role in this infection. Importantly, the team showed that patients who recovered from SARS 17 years ago after the 2003 outbreak, still possess virus-specific memory T cells and displayed cross-immunity to SARS-CoV-2. Worse Than the Disease? Reviewing Some Possible unintended Consequences of the mRNA Vaccines against COVID-19 Stephanie Seneff and Greg Nigh - International Journal of Vaccine Theory, Practice, and Research 2021 Sars-CoV-2 RNA reverse-transcribed and integrated into the human genome To experimentally corroborate the possibility of viral retro-integration, we describe evidence that SARS-CoV-2 RNAs can be reverse transcribed in human cells by reverse transcriptase (RT) from LINE-1 elements or by HIV-1 RT, and that these DNA sequences can be integrated into the cell genome and subsequently be transcribed. Human endogenous LINE-1 expression was induced upon SARS-CoV-2 infection or by cytokine exposure in cultured cells, suggesting a molecular mechanism for SARS-CoV-2 retro-integration in patients. This novel feature of SARS-CoV-2 infection may explain why patients can continue to produce viral RNA after recovery and suggests a new aspect of RNA virus replication. Scientists focus on how immune system T cells fight coronavirus in absence of antibodies Reuters - July 2020 Robust T cell immunity in convalescent individuals with asymptomatic or mild COVID-19 - biorxiv.org 2021 SARS-CoV-2 induces robust memory T cell responses in antibody-seronegative and antibody-seropositive individuals with asymptomatic or mild COVID-19. ABSTRACT SARS-CoV-2-specific memory T cells will likely prove critical for long-term immune protection against COVID-19. We systematically mapped the functional and phenotypic landscape of SARS-CoV-2-specific T cell responses in a large cohort of unexposed individuals as well as exposed family members and individuals with acute or convalescent COVID-19. Acute phase SARS-CoV-2-specific T cells displayed a highly activated cytotoxic phenotype that correlated with various clinical markers of disease severity, whereas convalescent phase SARS-CoV-2-specific T cells were polyfunctional and displayed a stem-like memory phenotype. Importantly, SARS-CoV- 2-specific T cells were detectable in antibody-seronegative family members and individuals with a history of asymptomatic or mild COVID-19. Our collective dataset shows that SARS-CoV-2 elicits robust memory T cell responses akin to those observed in the context of successful vaccines, suggesting that natural exposure or infection may prevent recurrent episodes of severe COVID-19 also in seronegative individuals. New York Times - Nov 2020 Immunity to the Coronavirus May Last Years - New Data How long might immunity to the coronavirus last? Years, maybe even decades, according to a new study — the most hopeful answer yet to a question that has shadowed plans for widespread vaccination. Eight months after infection, most people who have recovered still have enough immune cells to fend off the virus and prevent illness, the new data show. A slow rate of decline in the short term suggests, happily, that these cells may persist in the body for a very, very long time to come. Nature - Immunology Pre-existing immunity to SARS-CoV-2: the knowns and unknowns. July 2020 T cell reactivity against SARS-CoV-2 was observed in unexposed people; however, the source and clinical relevance of the reactivity remains unknown. It is speculated that this reflects T cell memory to circulating ‘common cold’ coronaviruses. It will be important to define specificities of these T cells and assess their association with COVID-19 disease severity and vaccine responses. PMC article - June 2020 Seasonal Influenza Vaccination and the Heightened Risk of Coronavirus and Other Pandemic Virus Infections: Fact or Fiction? "When an individual is infected by an ‘evolved’ strain with a new dominant antigen, slightly different from the ‘original’ strain against which the person has been vaccinated, the immune system produces antibodies against the ‘original’ strain through preformed high- affinity memory B cells that inhibit activation of naïve B cells resulting in a weak immune response against the new ‘dominant’ strain. Hence, the risk of infection paradoxically increased in vaccinated individuals as compared to unvaccinated individuals." Dr Zach Bush MD.com
"The last 30 years of microbiome research necessitates a radical shift in our model of human health. This new science of bacteria, fungi, parasites and viruses necessitates a restructuring of our biologic models of genomics, proteomics, inflammation, carcinogenesis, immunity, and infectious disease. The last three decades has also seen a catastrophic increase in childhood chronic diseases and infertility in young adults. The trajectory of these disease curves predicts the collapse of the human population and the likelihood of our own extinction within the century. The simultaneous microbiome research in soil, water, and air systems of the planet provide additional insight into the crisis, demonstrating that the collapse of human health and survival is symptomatic of a fundamental collapse of planetary health and biology" They don't know what they are doing
the vaccine paradigms shaky assumptions - Childrens Health Defense.org As the endlessly reassuring pronouncements about high-risk Covid-19 vaccines indicate, vaccine scientists are nothing if not confident. Underlying their overweening confidence is a paradigm that has remained essentially unchanged since vaccination’s inception, notwithstanding seismic changes in vaccine technology and vaccine schedules. This paradigm narrowly evaluates a given vaccine’s effects against the target illness but pays little (if any) heed to vaccinated individuals’ overall health or to overall mortality. Adherents of the prevailing paradigm also display a surprising lack of curiosity about whether vaccines have different impacts on boys versus girls or whether the sequence and combination in which vaccines are given matter. Autoantibodies in Autism Spectrum
We conducted the first systematic review and evaluated available evidence for the association between ASD and major specific autoantibodies. 19 studies with totaling 1610 ASD patients and 1299 controls included. ASD children expressed higher levels of antibodies reactive to anti-brain antibodies, anti-endothelial cell antibodies, anti-nuclear antibodies, and anti-folate receptor antibodies, compared to healthy controls. The results have implications for the development of diagnostic guidelines and therapeutic targets for possible autoimmune-mediated ASD subtypes. Influenza vaccination and respiratory virus interference among Dept of Defense personnel during the 2017 - 2018 influenza season - Science Direct. Personnel who were vaccinated with a flu shot were significantly more likely to get Coronavirus and human metapneumovirus infections. "Receipt of influenza vaccination was not associated with virus interference among our population. Examining virus interference by specific respiratory viruses showed mixed results. Vaccine derived virus interference was significantly associated with coronavirus and human metapneumovirus; however, significant protection with vaccination was associated not only with most influenza viruses, but also parainfluenza, RSV, and non-influenza virus coinfections". Infusions of stem cells from cord blood improves Autism symptoms Autologous Cord Blood Infusions Are Safe and Feasible in Young Children with Autism Spectrum Disorder: Results of a Single‐Center Phase I Open‐Label Trial Behavioral improvements were observed during the first 6 months after infusion and were greater in children with higher baseline nonverbal intelligence quotients. These data will serve as the basis for future studies to determine the efficacy of umbilical cord blood infusions in children with ASD. Aluminium in Brains linked to Autism - Prof Christopher Exley 'Perhaps we now have the link between vaccination and autism': Professor reveals aluminium in jabs may cause sufferers to have up 10 times more of the metal in their brains than is safe
Study finds record levels of Aluminium in Autistic Childrens Brains - Vaxxter Estimated Prevalence of Children with diagnosed Developmental disabilities in the US - 2014 to 2016 - data from - CDC - Gov.org Key fndings: Data from the National Health Interview Survey During 2014–2016, the prevalence of children aged 3–17 years who had ever been diagnosed with a developmental disability increased from 5.76% to 6.99%. Neil Z Miller - The U.S Department of Health and Human Services and CDC have released the latest numbers on autism rates in the United States. 1 in 35 children (8-12 years of age) have autism. 1 in 28 boys (3-17 years of age) have autism. More than 6% of our children have a developmental disability (1 in 16). More than 8% of our boys have a developmental disability (1 in 12). These are unsustainable rates of autism and developmental disability! Dirty vaccines: New Corvela study Reveals Prevalence of Contaminants Every Human Vaccine Tested Was Contaminated by Unsafe Levels of Metals and Debris Linked to Cancer and Autoimmune Disease, New Study Reports Researchers examining 44 samples of 30 different vaccines found dangerous contaminants, including red blood cells in one vaccine and metal toxicants in every single sample tested – except in one animal vaccine. Hepatitis B Vaccine ‘Significantly Increased’ IL-6, A Bio-Marker for Autism’: Mainstream Media Silence Sun Yat-sen University’s (a Top 10 university in China) Dr. Zhibin Yao is not a household name in the American autism community, but perhaps he should be. Not only is he American-educated (University of Pittsburgh) and the author of 33 peer-reviewed studies, but he’s also the lead author of two of the most important biological studies ever done analyzing how, exactly, a vaccine can cause autism. Icandecide.org Check out the Informed Consent Action Network here. Vaxxed the Movie - Free full movie on Bitchute. Vaxxed cover up to catastrophe. Nagalase a stealth bomber which destroys your Immune system Information about Dr Bradstreets work on GcMAF (macrophage activating factor) and Nagalase. Nagalase protein enzyme may be introduced via vaccination. Nagalase prevents Vit D binding to Gc protein to make GcMAF - if binding doesn't happen the whole immune system is compromised and cannot fight against cancer cells and other diseases. Cytokine storms ensue and destroy the body further. Unresolved viruses and bacterial infections can persist in the body without enough GcMAF (macrophage activating factor) to destroy them. Atypical B cells and impaired SARS-CoV-2 neutralisation following booster vaccination in the elderly - MedRxiv - 11th October 2022
"This expansion of atypical B cells and impaired T cell responses may contribute to the generation of less affinity-matured antibodies, with lower neutralizing capacity post-third dose in the elderly. Altogether, our data reveal the extent and potential mechanistic underpinning of the impaired vaccine responses present in the elderly after a booster dose, contributing to their increased susceptibility to COVID-19 infection." 'Vaccine Hesitancy' is 1 of WHO's Top 10 Global Threats - but Flu Shot Data Tells a Different Story - The Epoch Times - 12th October 2022
In 2019, the World Health Organization (WHO) proposed 10 threats to global health, such as air pollution, non-communicable diseases, global influenza pandemic, Ebola and other high-threat pathogens, weak primary health care, and HIV. Among them, vaccine hesitancy was also mentioned, which many people might find surprising. Panda Position Review COVID-19 Vaccines - pandata.org - October 2022
PANDA’s comprehensive multidisciplinary review has found that mass Covid-19 vaccination has been a failed experiment. Mass public-health measures always involve a trade-off between expected benefits and known and potential risks or harms. Harms include both short-term and long-term or inter-generational harms (e.g. poverty). Separately, they must at all times comply with basic human rights requirements. These fundamental realities have been ignored in much of the public-health response to the Covid-19 event, including mass vaccination. Judicial Watch Uncovers Biden Administration Propaganda Plan to Push COVID Vaccine - Judicial Watch - 4th October 2022
Major [Public Education] Projects in April Vaccine engagement package to all entertainment talent and management agencies Vaccine engagement package to all media companies and show producers Outreach to major culture event producers Outreach with WCDT [likely We Can Do This] brand and engagement ideas to major businesses and associations Launch Community Corps Business Chapter Start celebrity Share the Mics Gene-based vaccinaton - quo vadis? - Doctors4covidethics - 10th October 2022
The concept underlying vaccine development is straightforward: application of a harmless derivative of an infectious agent should stimulate the immune system to produce antibodies that protect against that agent. Introduction of any foreign substance into the body can never be entirely devoid of risks, however, so the prime question to be addressed is whether the benefit can be expected to outweigh the risks. It is 5 past 12! - Geert Van Bossche - Voice for Science and solidarity - 9th October 2022
For me, it has become unbearable to see how our health authorities, our experts and governments are still trying to make people believe that the COVID-19 vaccines are safe and that they will be able to control the pandemic. In this presentation I made a few PowerPoint slides. I will show you that, as I have already been saying in the past, this is an unbelievable blunder. It is an insult to the science. It is unbelievable how scientists can still support this kind of strategy, whereas there is overwhelming evidence that the mass vaccination and the upcoming or updated omicron vaccination will just make things much, much worse. So, this news is sobering, but I have no choice. I have to share it because we have a passion for the truth and we believe that the truth will prevail. Why did the CDC hide the v-safe data from the American people for almost 2 years? - Steve Kirsch - Substack - 6th October 2022
Because it clearly shows that these vaccines are the most dangerous vaccines we've ever created, that's why. V-safe is a voluntary safety monitoring program put in place by the CDC to monitor adverse reactions after people take a vaccine. The v-safe data shows that 33.1% of the people who got the vaccine suffered from a significant adverse event and 7.7% had to seek professional medical care. Investigation launched after deaths of 39 new born Scots babies in record breaking mortality spikes - Scottish Daily Express - 1st October 2022
"Its the second time in six months that death records have hit a worrying level and now an official review into the circumstances hopes to reveal what went wrong." ADVERSE REACTIONS - OUR OPINION: For the second time this year deaths of Scottish babies have spiked. Another investigation (the other one found nothing) has been launched. Lets hope they notice the elephant in the room this time. They stare at the numbers scratching their heads while babies die. If the investigators need a hint: - it might be the PEG, Spike or other toxic ingredients that the mother and baby has been exposed to. PEG laden blue-green breast milk would do the trick too. A Case Report: Multifocal Necrotizing Encephalitis and Myocarditis after BNT162b2 mRNA Vaccination against COVID-19 - MDPI - 1st October 2022
"Although there was no history of COVID-19 for this patient, immunohistochemistry for SARS-CoV-2 antigens (spike and nucleocapsid proteins) was performed. Surprisingly, only spike protein but no nucleocapsid protein could be detected within the foci of inflammation in both the brain and the heart, particularly in the endothelial cells of small blood vessels. Since no nucleocapsid protein could be detected, the presence of spike protein must be ascribed to vaccination rather than to viral infection. The findings corroborate previous reports of encephalitis and myocarditis caused by gene-based COVID-19 vaccines." Evidence of harm - Steve Kirsch -Substack - 22nd September 2022
Here’s a high level collection of some of the most compelling pieces of evidence I’ve seen to date. This is not an exhaustive list, but just the key pieces of data that are impossible to explain if the vaccines are safe and effective. Curing the pandemic of misinformation on COVID-19 mRNA vaccines through real eveidence-based medicine - Part 1 - Journal of Insulin Resistance - 26th September 2022
Conclusion: It cannot be said that the consent to receive these agents was fully informed, as is required ethically and legally. A pause and reappraisal of global vaccination policies for COVID-19 is long overdue. As Autism Rates Soar, Parents and Scientists Seek Answers - The Defender - 22nd August 2022
The stark rise in autism rates in the U.S. is difficult to ignore, but what’s driving the increase remains a mystery. Data suggest that 1 in 30, or 3.49%, of children ages 3 to 17 were diagnosed with autism spectrum disorder (ASD) in 2020. The Strange Case of the Gates Foundation, the US CDC and New Zealand Health Data - The Expose - 24th September 2022
How NZ cooperated with a global biotech vaccine experiment The record rates of excess all-cause mortality in highly vaccinated countries including New Zealand show that a disaster has expanded silently and spread rapidly fanned by biotechnology lobbying and government-sponsored pandemic policies. How did this happen? (If you have heretofore closed your eyes and ears, mind or heart to the accumulating scientific evidence of Covid vaccine harm published in journals, but now you wish to catch up, you can reference This succint review on Substack). This Key Major Risk of the Omicron Boosters Can't Be Ignored - The Epoch Times - 16th September 2022
"The new Omicron vaccines will be widely used in the population, so we cannot ignore the experimental exploration of the ADE effect. This is because it is a major issue that affects the lives and health of so many people." The Naked Absurdity of Global Public Health - Brownstone Institute - 14th September 2022
Something is fundamentally wrong with global public health. More accurately, something is fundamentally wrong with the mindset of global health professionals, particularly those in positions of leadership. It has become normal to speak, repeat, and defend complete absurdity, as if illusions and fantasies are real. There are no sanctions for operating in this way – indeed it is proving highly successful. Adverse Effects of the Pfizer Vaccine Covered Up by the Israeli Ministry of Health - Brownstone Institute - 20th September 2022
The Israeli MOH had no adverse events reporting system for the entire year of 2021. They commissioned a research team to analyze the reports from a new system implemented on December 2021. A leaked video reveals that in June, the researchers presented serious findings to the MOH, that indicated long-term effects, including some not listed by Pfizer, and a causal relationship. The Ministry published a manipulative report, and told the public that no new signal was found. The SARS-CoV-2 as an instrumental trigger of autoimmunity - PubMed - 19th February 2021
As previously discussed, molecular mimicry exists between SARS-CoV-2 and human components, therefore if autoimmune manifestations will start appearing in vaccinated individuals, we believe that mRNA sequences coding for peptides shared with humans should be removed from vaccines. Vaccination strategy should also be considered in order to decrease the danger of the COVID-19 infection in the most susceptible individuals, along with the autoimmune risks of severe illness. "Major Suppression" Of Adverse Events By CDC: Dr. harvey Risch & Dr. Kelly Victory - Ask Dr. Drew - Rumble - Dr. Drew - 13th September 2022
"Not only have we seen major suppression of information about adverse events by FDA, CDC, governments in general... but this isn't new," says Yale epidemiologist Dr. Harvey Risch. "There are all these games that get played to hide the adverse events." Pharmaceutical Regulatory Affairs Expert Calls on Authorities to Suspend 'Provisional Approval' Status Granted to COVID-19 Vaccines - The Epoch Times - 15th September 2022
‘Transparency and Independent Oversight is Needed’This comes after the TGA reported 135,978 cases of total adverse events following COVID-19 immunisations to Sept. 4. The TGA has also identified 13 reports where the cause of death was “linked” to vaccinations from the 937 reports it received and reviewed. CDC Director Admits Agency Gave False Information On COVID-19 Vaccine Safety Monitoring - The Epoch Times - 13th September 2022
The director of the Centers for Disease Control and Prevention (CDC) has acknowledged publicly for the first time that the agency gave false information about its COVID-19 vaccine safety monitoring. "We Could Have Saved 600-800K Lives": Dr. Paul Marik Explains the Latest Study on Ivermectin & COVID - Rumble - 12th September 2022
"The human cost is enormous and the reason this was denied is simply profiteering and making money for big pharma and their interests" Episode 284: The Fine Line - The Highwire - 8th September 2022
Dr. Drew’s ‘Aha’ Moment; Doc Sues Board For $35 Million; Vaccine OK’d on 8 Mice; Journey into the Mind; Del Reveals ‘The Real Alex Jones’ 2-Part Event Guests: Paul Thomas, MD; Mattias Desmet, PhD; Dr. Maria Hubmer-Mogg. Pfizer, FDA, CDC Hid Proven Harms to Male Sperm Quality, Testes Function, From mRNA Vaccine ingredients - Amy Kelly - Substack - 5th September 2022
When the COVID-19 vaccine rollout to the public began in late 2020, medical professionals, public health agencies, and government spokespeople all assured the American public that the novel mRNA vaccines did not cause negative systematic effects to human bodies. They promised the public, many of whom were skeptical about the safety of a drug brought to market at “warp speed,” that the vaccines were “safe and effective.” Excess mortality in Germany 2020-2022 - ResearchGate - August 2022
"Something must have happened in April 2021 that led to a sudden and sustained increase in mortality in the age groups below 80 years, although no such effects on mortality had been observed during the COVID-19 pandemic so far." Pre-exposure to mRNA-LNP inhibits adaptive immune responses and alters innate immune fitness in an inheritable fashion - BioRxiv - 20th August 2022
"In summary, the mRNA-LNP vaccine platform induces long-term immunological changes that can affect both adaptive immune responses and heterologous protection against infections, some of which can be inherited by the offspring. More studies are needed to understand the mechanisms responsible for these effects and determine this platform's impact on human health." Dark-Field Microscopic Analysis on the blood of 1,006 Symptomatic Persons After Anti-COVID mRNA Injections from Pfizer/BioNtech or Moderna - IJVTPR - 12th August 2022
"In the present study we analyzed with a dark-field optical microscope the peripheral blood drop from 1,006 symptomatic subjects after inoculation with an mRNA injection (Pfizer/BioNTech or Moderna), starting from March 2021. There were 948 subjects (94% of the total sample) whose blood showed aggregation of erythrocytes and the presence of particles of various shapes and sizes of unclear origin one month after the mRNA inoculation. In 12 subjects, blood was examined with the same method before vaccination, showing a perfectly normal hematological distribution. The alterations found after the inoculation of the mRNA injections further reinforce the suspicion that the modifications were due to the so-called “vaccines” themselves." INVESTIGATION: The sinister reasons COVID Vaccines are not being updated annually like Flu Jabs despite the alleged SARS-CoV-2 Virus mutation several times - The Expose - 1st September 2022
"The original strain Wuhan Hu1, was never given a Greek letter. It was pre-alpha. This was because it had died out completely before the WHO devised its lettering system for variant names. So looking at the table above, what should have happened, had Covid-19 vaccines followed the normal vaccination updating procedure, is that in late 2020 a trivalent vaccine should have been made coding for the proteins of Alpha, Beta and Epsilon. Then in 2021 a quadrivalent vaccine coding for Alpha,. Beta, Epsilon and Delta. Then in 2022, a bivalent vaccine should have been made coding for Delta and Omicron. Furthermore, knowing how pathogenic the spike proteins were, the vaccines should have been coding for viral nucleocapsid (case) proteins rather than their spike proteins.But none of that occurred. Instead, everyone was jabbed with a vaccine for Wuhan Hu1 1,2,3 or 4 times. The vaccines were not introduced until December 2020, by which time Wuhan Hu1 had almost vanished. So to date, nobody has been vaccinated for the correct variant. What is more absurd is the case of the Novavax vaccine." My Gratitude For the Apologies and Sincere Expressions of Regret - Brownstone Institute - 16th August 2022
Dear Friends and Valued Acquaintances: Sorry it’s taken me so long to write. Frankly I’ve been overwhelmed by all the signs of love and sincere regret so many of you have recently sent my way. In the UK - Adverse Reactions should be reported using the yellow card system at MHRA.Gov.uk.
|
All content posted on this site is commentary or opinion and is protected under Free Speech. This website and its authors are not responsible for content written by other contributing authors. The information on this site is provided for educational and recreational purposes only. It is not intended as a substitute for professional medical advice or professional advice of any kind. Licensed medical practitioners should always be consulted. This website and its authors assume no responsibility for the use or misuse of this material and assume no liability for any consequences associated with the use or misuse of this material.
All Rights Reserved.